Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 50 nM Rab14 siRNA (5′-CAACUACUCUUACAUCUUU-3′, Sigma-Aldrich) for 72 h using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2023Quote: ... scrambled (NT) shRNA (5’-GCGATAGCGCTAATAATTT-3’ SHC202; Sigma-Aldrich) or a shRNA specific for human SOX11 (100% identity to the equine SOX11 sequence ...
-
bioRxiv - Microbiology 2024Quote: ... a 5% solution of 3-Aminopropyltriethoxysilane (APTES, Sigma-Aldrich) in tetrahydrofuran (THF ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in 5 mL 0.03 M aspartic acid (Sigma, 11189, pH 5.0)) at 50°C for 120 min ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was stained with 5% phosphomolybdic acid reagent (PMA) (Sigma) and heated briefly using an industrial blow-dryer to visualize the total amounts of lipids loaded in each lane.
-
bioRxiv - Plant Biology 2020Quote: ... 10 μL of 5% (v/v) trifluoroacetic acid (TFA, Sigma-Aldrich) was added and incubated at 37°C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... 10 mM HEPES and 5 mM Ethylenediaminetetraacetic acid (EDTA, Sigma-Aldrich) and incubated in in a shaker incubator (500 rpm ...
-
bioRxiv - Biochemistry 2022Quote: ... which was passivated with 5% (W/V) pluronic acid (Sigma Aldrich) for 2 hr and washed trice with 25 mM potassium phosphate pH 7.5 buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% FBS and 50 nM Retinoic Acid (Sigma-Aldrich, Cat # R2625) and 10 μM Rock inhibitor (Y-27632 ...
-
bioRxiv - Neuroscience 2023Quote: ... and imaging buffer comprising 5 mM 3,4-dihydroxybenzoic acid (Sigma, P5630), 50 µM trolox quinone ...
-
bioRxiv - Pathology 2023Quote: ... aristolochic acid I (AAI, A9451, Sigma; 5 mg/kg body weight) or normal saline (NS ...
-
bioRxiv - Immunology 2024Quote: ... It was filled with 5 M sulfuric acid (#258105, Sigma-Aldrich) and left for 90 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS (pH 7.4) and incubated in 10 ml PBS (pH 7.4) containing 5 mM catalyst 5-methoxyanthranilic acid (Sigma Aldrich) and the ligand coupled to HATRIC ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Systems Biology 2024Quote: ... lysates were reduced with 5 mM 5-tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (Sigma-Aldrich) for 2 min at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3-(2-Methyl-5-nitro-imidazol-1-yl)-N-(2,2,2-trichloro-1-phenylamino-ethyl)-propionamide) (Sigma-Aldrich SML1503). Drugs were diluted in culture media at treatment.
-
bioRxiv - Microbiology 2024Quote: ... After 24 h media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37°C in 5% CO2 for 3 h ...
-
bioRxiv - Genetics 2020Quote: ... 137.14 mg of 2-methylpyridine-3-carboxylic acid (Sigma Aldrich, cat. 325228) were resuspended in 500 μl DMSO anhydrous (Sigma Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Systems Biology 2022Quote: ... of 5,5’dithiobis-2-nitrobenzoic acid conversion to 2-nitro-5-thiobenzoic acid in the presence of Coenzyme A thiol generated during citrate production (CS0720, Sigma) as previously described.62
-
bioRxiv - Physiology 2023Quote: ... of 5,5’dithiobis-2-nitrobenzoic acid conversion to 2-nitro-5-thiobenzoic acid in the presence of Coenzyme A thiol generated during citrate production (CS0720, Sigma) as previously described (Crouch et al. ...
-
bioRxiv - Biophysics 2023Quote: ... the acrylate functionalized photodegradable monomer was synthesized by suspending 4-[4-(1-hydroxyethyl)-2-methoxy-5-nitrophenoxy]butyric acid (0.0166 mol, Sigma-Aldrich) in anhydrous DCM (90 mL) ...
-
bioRxiv - Cancer Biology 2024Quote: 6-(5-Pyrazolyl)pyridine-2-carboxylic acid (0.1 mM, Accela ChemBio Inc.) in dry N,N-Dimethylformamide (DMF) (Sigma Aldrich) was dissolved and stirred with N,N’-Dicyclohexylcarbodiimide (DCC ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM tris(2-carboxyethyl)phosphine hydrochloride (Sigma), 1X cOmplete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Tubulin (B-5-1-2, Sigma), mouse anti-CHC (X22 ...
-
bioRxiv - Developmental Biology 2021Quote: For 5-bromo-2-deoxyuridine (BrdU; Sigma-Aldrich) incorporation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-Iodo-2’-deoxyuridine (IdU) (I7125 from Sigma), 100µM.
-
bioRxiv - Cell Biology 2022Quote: ... 5’-Chloro-2’-deoxyuridine (CIdU) (C6891 from Sigma), 100µM ...
-
bioRxiv - Neuroscience 2020Quote: ... and 15 mM 5’-Fluor-2’deoxyuridine (Sigma), were added after 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Dropped ∼ 2 μl of 5 mM levamisole (Sigma) onto a new NGM plate and transferred several animals into it ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-2’-deoxyuridine (BrdU) (Sigma-Aldrich) was used for cell cycle length assessment ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μM 5- fluoro-2′-deoxyuridine (Sigma, F0503), 1 μM uridine (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μM 5-fluoro- 2’-deoxyuridine (Sigma, F0503), 1 μM uridine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 5-Bromo-2’-deoxyuridine (BrdU; Sigma-Aldrich, B5002), 5’-(N-ethylcarboxamido) ...
-
bioRxiv - Cancer Biology 2020Quote: ... BrdU (5-Bromo-2′-deoxyuridine; Sigma Aldrich, USA) was intraperitoneally administered (50 mg/kg ...
-
bioRxiv - Cancer Biology 2020Quote: ... BrdU (5-Bromo-2′-deoxyuridine; Sigma Aldrich, USA) was intraperitoneally (i.p ...
-
bioRxiv - Cancer Biology 2020Quote: ... BrdU (5-Bromo-2′-deoxyuridine; Sigma Aldrich, USA) was administered i.p ...
-
bioRxiv - Systems Biology 2021Quote: ... and 5% vol/vol 2-butylamine (Sigma-Aldrich) solution in toluene (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... BrdU (5-Bromo-2’-deoxyuridine; Sigma-Aldrich, B5002) was administered in drinking water (0.8 mg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... or Tubulin (Sigma-Aldrich, B-5-1-2), and subsequently with the according HRP-tagged secondary antibodies (Jackson Immunoresearch) ...