Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 3-(4,5-dimethylthiazolyl-2-yl)-2–5 diphenyl tetrazolium bromide (MTT, Sigma, St. Louis, Missouri, USA) was introduced ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Microbiology 2020Quote: ... 49 with 1.5% weight vol−1 agar supplemented with 2 mg mL−1 5-Fluoroorotic acid (USBiological, USA) and 5 µg mL−1 uracil (Sigma–Aldrich USA) in order to select for plasmid excision ...
-
bioRxiv - Immunology 2024Quote: ... followed by 5 min in 5% phosphotungstic/phosphomolybdic acid solution for 5 min (Sigma HT152 and HT153 respectively). Slides were rinsed in diH2O then stained for 4 min in Aniline Blue solution ...
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Immunology 2022Quote: ... was modified with 5-Norbornene-2-acetic acid succinimidyl ester (Nb-NHS) (Sigma Aldrich #776173) using a ratio of 1g Nb-NHS ...
-
Hepatic iNKT cells facilitate colorectal cancer metastasis by inducing a fibrotic niche in the liverbioRxiv - Immunology 2024Quote: ... Sections were washed 2 times for 5 minutes in 0.5% glacial acetic acid (Sigma-Aldrich). Tissue sections were dehydrated through an ethanol series (70% ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mL of growth media supplemented with 5 mg/mL 6-aminocaproic acid (Sigma-Aldrich) was added to each well ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... The matrix consisted of a 9:1 mixture of 2,5-dihydroxybenzoic acid and 2-hydroxy-5-methoxybenzoic acid (super-DHB, Sigma-Aldrich) at a final concentration of 10 mg/ml dissolved in chloroform ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Microbiology 2020Quote: ... samples were incubated with 3% acetic acid for 5 min and followed by Alcian blue (Sigma, B8438) (in 3% acetic acid ...
-
bioRxiv - Microbiology 2023Quote: ... mice (n=5 mice for each line) were orally administered with IAA (3-indoleacetic acid, auxin, Sigma) and by an intraperitoneal injection on a daily basis (Brown and Sibley ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 4 mM 5-bromo-4-chloro-3-indolyl α-D-N-acetylneuraminic acid (Sigma) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... 5-10 mg dry sample was dissolved in 600 μl D2O (99.9%) and added 5 μl 3-(Trimethylsilyl) propionic 2,2,3,3-d4 acid (TSP, Sigma Aldrich) as an internal standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 g/L L-glutamic acid (Sigma-Aldrich) and 0.1 mg/mL each of required amino acids ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sigma Aldrich 34860)/5% glacial acetic acid (GAA, Sigma Aldrich A6283) at -20°C for 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... and boric acid (5 mg/ml, Sigma-Aldrich). Next ...
-
bioRxiv - Biophysics 2020Quote: 5) Ethylenediaminetetraacetic (EDTA) acid solution (Sigma, 03690-100ML)
-
bioRxiv - Neuroscience 2021Quote: ... and 5% acetic acid (volume:volume; Sigma-Aldrich 338826) was poured into each chamber and allowed to set for 30 minutes before females were introduced by gentle aspiration 13,37 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 8-hydroxy-5-quinolinecarboxylic acid (Sigma-Aldrich; SML0057), S-(5′-Adenosyl)-L-homocysteine (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2022Quote: ... Digestion was stopped using 5% trifluoracetic acid (Sigma) to pH 2 to 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μg/mL of ascorbic acid (Sigma-Aldrich), 1% of chemically defined lipid concentrate (Gibco) ...