Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Plant Biology 2021Quote: ... by Phenol:Chloroform:Isoamyl Acid (25:24:1; Sigma) extraction and ethanol precipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... 2.5% 2-Mercaptoethanol (Sigma, 60-24-2), and sonicated ...
-
bioRxiv - Cancer Biology 2020Quote: ... 24 μg/mL adenine (A2786, Sigma-Aldrich) and 6 μM Y-27632 (ALX-270-333 ...
-
bioRxiv - Plant Biology 2021Quote: ... 24-epi-brassinolide (epiBL, Sigma Aldrich®) dissolved in DMSO was added to a 1 µM final concentration and seedlings were further incubated under the described conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... or 1000 ng 24-epiBL (Sigma-Aldrich) was spotted at the top of the lamina of seedlings (Fujioka et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... or p3xFLAG-Myc-CMV-24 (Sigma-Aldrich). Competent JM109 Escherichia coli cells (Takara ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pretreatment with ArA (Sigma-Aldrich, 24 µM) was performed 16 h before MB incubation.
-
bioRxiv - Neuroscience 2023Quote: ... aa 17-24 (Millipore Sigma, Cat# MABN10). Membranes were then washed 3 times with PBST and incubated in HRP-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2024Quote: ... 24 μg/ml adenine (A8626; Sigma-Aldrich), 100 U penicillin ...
-
bioRxiv - Cancer Biology 2022Quote: ... 24 mg/ml adenine (A2786, Sigma-Aldrich), 10 mM Y-27632 (ALX-270-M0055 ...
-
bioRxiv - Immunology 2023Quote: ... 24 μM 2-mercaptoethanol (Sigma-Aldrich, M3148), 0.05% low-density lipoprotein (STEMCELL Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 24 μg/ml insulin (Millipore Sigma, I6634), 1% Glutamax (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 24 mM DTT (Sigma-Aldrich)) ...
-
bioRxiv - Microbiology 2022Quote: ... and 24 hours of mitomycin C (Sigma) addition ...
-
bioRxiv - Microbiology 2024Quote: ... and 24 µg/ml pantothenic acid (Sigma).
-
bioRxiv - Molecular Biology 2024Quote: ... H4 (2-24 aa) (Millipore, 12-372), H4K5/8/12/16ac (1-18 aa ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alive embryos older than 16 ss were additionally mounted with 0.016% ethyl 3-aminobenzoate methanesulfonate salt (Tricaine, Sigma) in the LMA and added to the E3 medium to prevent movement during imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... Adult zebrafish were anesthetized in standard E3 medium containing 0.4% tricaine (ethyl 3-aminobenzoate methanesulfonate salt; Sigma-Aldrich) before ventricular resection as described previously (Xiao et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... the animals were anesthetized using 0.1% Ethyl 3-aminobenzoate methanesulfonate (MS-222, Sigma-Aldrich, St Louis, MO, USA) dissolved in Holtfreter’s solution ...
-
bioRxiv - Immunology 2021Quote: Dechorionated larvae were anesthetized with 0.02% (w/v) ethyl 3-aminobenzoate methanesulfonate (MS-222) (Tricaine, Sigma-Aldrich, A5040) supplemented with 0.2mM PTU ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were anesthetized with Ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Tricaine; Sigma-Aldrich Corp., St. Louis, MO). All animal procedures were carried out in accordance with guidelines established by the University of Kentucky Institutional Animal Care and Use Committee and the ARVO statement on the use of animals in research.
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711) (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2023Quote: Zebrafish larvae were euthanized in 0.04% MS-222 (Ethyl 3-aminobenzoate methane sulfonic acid salt 98%, Sigma Aldrich) for 15 min and fixed for 30 min at room temperature in 4% paraformaldehyde (PFA) ...
-
bioRxiv - Cell Biology 2024Quote: ... anesthetized in E3 medium with 0.016% (w/v) buffered tricaine (3-amino benzoic acid ethyl ester; Sigma-Aldrich), and embedded in 0.8% (w/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... Stained zebrafish larvae were anesthetized with 0.016% (m/v) Ethyl 3-aminobenzoate methanesulfonate salt (Tricaine; Sigma-Aldrich, A5040) and embedded in 1.8% low melting point agarose (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... zebrafish larvae were added to E3 media containing 0.08 mg/mL tricaine (MS222/ethyl 3-aminobenzoate; Sigma-Aldrich). Once non-motile ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SC-Leu-Trp-His +5 mM 3-AT (3-Amino-1,2,4-triazole, Sigma, 18056-25G). Plates were incubated at 30°C and imaged daily for at least three days.
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with/without the oxidative agent H2O2 (250 μM for 3 h) or TBH (250 μM for 1 h) (tert-butyl hydroperoxide solution, Sigma-Aldrich) in the absence/presence of nanoalgosomes ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Immunology 2021Quote: ... Media was replaced 24 hours post-transfection and harvested 24 hours later for filtration with a 0.45 μm filter (SteriFlip, Millipore). Approximately 1 million cells were transduced with 10 mL filtered virus ...
-
bioRxiv - Genetics 2023Quote: Differentiated monolayers were treated with 0.01-5 µM 25 hydroxycholesterol (25-HC) as well as 0.1 µM - 2.5 µM 24 hydroxycholesterol (24-HC) and 27 hydroxycholesterol (27-HC) (Sigma-Aldrich). In parallel ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5-(N-ethyl-N-isopropyl)-amiloride (EIPA, Sigma), an inhibitor of Na+/H+ exchange ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed 3 times with PBST and 100 μL of o-phenylenediamine dihydrochloride (SigmaFast OPD, Sigma) substrate was added per well ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed 3 times with PBST and 100 µL of o-phenylenediamine dihydrochloride (SigmaFast OPD, Sigma) substrate was added per well ...
-
bioRxiv - Synthetic Biology 2020Quote: Synthetic lipid 1,2-di-O-phytanyl-sn-glycero-3-phosphocholine (Avanti) was diluted in tridecane (Sigma-Aldrich) to a final concentration of 15 mg/mL ...
-
bioRxiv - Physiology 2024Quote: ... A 3:2 dilution of Oil Red O filtered solution (0.5 g/100 mL isopropanol; Sigma-Aldrich) was added to cells and incubated for 5 minutes at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 5 M tert-butyl hydroperoxide (TBHP) (Sigma Aldrich, United States) were prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... WT neurons were treated for 24 h with APOE2 protein (5 μg/ml, #SRP4760, Sigma-Aldrich), APOE4 protein (5 μg/ml ...