Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells or slides were stained with 3 g/L Oil Red O (cat#O0625, Sigma) at 37°C for 1 hr ...
-
bioRxiv - Microbiology 2020Quote: ... either 24 μM of AZT (Sigma) or 10 μM of NVP (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... 24 hours later 5mg ovalbumin (Sigma) and 100μg anti-hOX40 or isotype control were given via i.p ...
-
bioRxiv - Microbiology 2022Quote: ... 24 μg/mL Adenine (Sigma-Aldrich), 10 ng/mL recombinant human epidermal growth factor (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... 24 µg/mL Adenine (Sigma - Aldrich), 0.4 µg/mL hydrocortisone (Sigma - Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and 24 µg/ml gentamicin (Sigma) for several hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 24 hours with DMSO (Sigma) as the solvent control (Naumova et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... 24 μg/ml Adenine (Sigma-Aldrich), 100 nM ROCK inhibitor (Enzo Life Sciences) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 24 μg/mL adenine (Sigma-Aldrich #) and 1% Penicillin-Streptomycin (Gibco #15140122)] ...
-
bioRxiv - Immunology 2023Quote: Zebrafish embryos at 24 hpf were treated with 5 μM 4-OHT (H7904, Sigma) for 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were transferred to cluster tubes (Axygen, PN MTS-11-12-C) and treated with 24 µL of 1:1 solution of Benzonase (Millipore Sigma, PN 70746-3) and 100 mM MgSO4 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Bioengineering 2024Quote: Cover glasses (MATSUNAMI, 24 × 24 mm, Thickness No. 1) were incubated in 0.01% PLL solution (Sigma, P4707) for 5 minutes and then air dried at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were anesthetized with Ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Tricaine, Sigma-Aldrich, St. Louis, MO) and adults were euthanized by rapid cooling as previously described (Wilson et al. ...
-
bioRxiv - Zoology 2021Quote: 200 mg Et-IPA (a-Ethyl-3-hydroxy-2,4,6-triiodohydrocinnamic acid, CAS 96-84-4, Sigma Aldrich) was dissolved in 4 ml edible corn oil ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the fish were immersed in fresh buffered Tricaine (3-amino benzoic acid ethyl ester; Sigma A-5040) diluted in system water (0.016%w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Zebrafish were sacrificed with a lethal dose of MS-222 (Ethyl 3-aminobenzoate methanesulfonate) (Sigma-Aldrich, UK), followed by washing with 0.5% sodium hypo chloride or bleach (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: Adult zebrafish were euthanized with 200 – 300 mg/L of ethyl 3-aminobenzoate methanesulfonate (tricaine) (Sigma, E10521) prior to dissection ...
-
bioRxiv - Neuroscience 2023Quote: ... length = 8.08 + 0.26 cm) were anesthetized with MS-222 (ethyl 3-amino benzoate methanesulfonic acid, Sigma Aldrich) and were ovariectomized by removing ovaries and fat bodies using a cauterizer through a small incision (~1 cm ...
-
bioRxiv - Developmental Biology 2023Quote: ... Labeled embryos were anesthetized with 0.17 mg/ml ethyl 3-aminobenzoate methanesulfonateMS-222 (E10521-50G, Sigma-Aldrich), embedded in 0.7% agarose gel ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were anesthetized with 200 mg/l 3-aminobenzoic acid ethyl ester (MS-222) (Sigma-Aldrich, A5040) and embedded laterally in 1.2% low-melting-point (LMP ...
-
bioRxiv - Microbiology 2024Quote: Larvae (2dpf) were manually dechorionated and anesthetized in E3 + 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma). Using a microinjector ...
-
bioRxiv - Neuroscience 2024Quote: ... Zebrafish larvae at 4 dpf were anaesthetised using 0.016 % ethyl 3-aminobenzoate methane sulfonate (MS-222, Sigma). They were then mounted in 1% low melting point agarose (LMP ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were anesthetized using 168 µg/ml (w/v) of Tricaine (ethyl 3-aminobenzoate methanesulfonate) (E10521, Sigma) in ERM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos older than 28 hpf were first anesthetized for 5–10 min in Ethyl 3-aminobenzoate methanesulfonate (MS-222) (Sigma-Aldrich, Saint Louis, MO, USA) in E3 medium ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... MICAL1#2 (5′CUCGGUGCUAAGAAGUUCU[dU][dU]3′) (75) and Rab35 (5′GCUCACGAAGAACAGUAAA[dU][dU]3′) (76) were synthetized by Sigma.
-
bioRxiv - Cell Biology 2024Quote: ... two siRNA sequences targeting different regions of NOK were designed as #1: 5’-GCAAGAAACAUUCAUGCAU-3’ and #2: 5’-GUCUUUCCCAGGGACACAA-3’ (SASI_Hs01_00043410 and SASI_Hs02_00351937, Sigma, St. Louis, MO, USA). The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Hop-22(29)-ene (Sigma-Aldrich, PubChem Substance ID: 32974796), also known as the short hopanoid diploptene ...
-
bioRxiv - Microbiology 2021Quote: ... followed by pH 8-buffered 25:24:1 phenol:chloroform:isomyl alcohol and 24:1 chloroform:isomyl alcohol (Sigma-Aldrich®). Extracts were concentrated using 100 kDa membrane centrifugation (Amicon®) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...