Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: Floating and adherent iMicroglia were collected on differentiation day 28-29 and replated 24-48 hours before treatment in uncoated ultra-low attachment 24-well plates (Corning, Sigma #CLS3473-24EA) in 400 μL iMicroglia Experiment Medium (iMicroglia Maturation Medium without TGFβ1 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were then washed 3 times with PBST before the addition of 100ul of .5mg/ml o-Phenylenediamine (Sigma) diluted in phosphate-citrate buffer with sodium perborate (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections of 3 μm in the thickness were conducted for Safranin O and fast green and TRAP (Sigma-Aldrich) staining ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegansbioRxiv - Neuroscience 2021Quote: ... 5 mg/mL Oil Red O (Sigma, O9755) in 100% isopropanol was prepared as a working solution and diluted 3:2 in 60% isopropanol on the day before use ...
-
bioRxiv - Genetics 2021Quote: ... 3 mM MgCl2 (Sigma, 7786-30-3), 0.1% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and EIF4E2 shRNA#3 (sh4EHP#3) (Sigma,). GIGYF2 shRNA#1 (shGIGYF2#1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... covered with 3-aminopropyltrimethoxysilane (3-APTS, Sigma) for 3 min for activation ...
-
bioRxiv - Neuroscience 2021Quote: ... oxygenated DAB (3-3’-diaminobenzidine, Sigma-Aldrich) was dissolved in 0.1 N HCl at a concentration of 5.4 mg/ml and subsequently diluted ten-fold into sodium cacodylate buffer (pH 7.4 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-mercaptobenzoic acid (3-MBA, Sigma-Aldrich)-capped gold nanoclusters (3-MBA-Au nanoclusters ...
-
bioRxiv - Biochemistry 2024Quote: ... 3% SDS (Sigma-Aldrich, 151-21-3), 25 mM β-glycerophosphate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... ultracel-3 (>3 kDa cutoff) concentrators (Millipore). 30 µl of concentrate was loaded for western blot analysis.
-
bioRxiv - Genetics 2021Quote: ... 200 µL chloroform–isoamyl-alcohol (24:1; Sigma Aldrich) were added ...
-
bioRxiv - Developmental Biology 2020Quote: ... 50 μM β-mercaptoethanol (Sigma, Cas # 60-24-2), 10 ng/mL LIF (ESGRO ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by 24 hours in 30% sucrose (Sigma, S1888) solution in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... sodium pyruvate (500 μM, Sigma, Catalog #113-24-6), nonessential amino acids solution (100 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 24 well chambers were coated with Matrigel (Sigma E6909) diluted in depleted medium for 1h at 37°C and assays were performed as described in Directional migration except the assay was performed for 24h.
-
bioRxiv - Cell Biology 2021Quote: ... for 24 h and then treated with isoproterenol (Sigma) for 6 h after which RNA was collected.
-
bioRxiv - Microbiology 2020Quote: ... IFN-γ (400 U/ml, 24 h, Sigma-Aldrich), IFN-λ1 (100 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... IFN-a2 (500 U/ml, 24 h, Sigma-Aldrich), IFN-γ (400 U/ml ...
-
bioRxiv - Genetics 2022Quote: ... for 24 – 48 hours and 2 μM doxycycline (Sigma) for 7 days ...
-
bioRxiv - Physiology 2021Quote: ... cardiomyocytes were seeded onto 24 well gelatin (Sigma, UK) coated V7 Seahorse plates (Agilent Technologies LDA UK Ltd ...
-
bioRxiv - Developmental Biology 2021Quote: ... Phenol-Chloroform-Isoamyl alcohol (25:24:1; Sigma-Aldrich) DNA extraction was performed on the nuclei and final DNA was resuspended in 25 mL of 10 mM Tris pH 8.0 (Applichem ...
-
bioRxiv - Biochemistry 2022Quote: ... or citrus pectin with DM 24-30% (P9311, Sigma) or OGs DP12DM5 (degree of polymerization centered on 12 and average DM of 5% ...
-
bioRxiv - Genomics 2022Quote: ... An equal volume of chloroform:isoamyl alcohol (24:1, Sigma) was added to the aqueous phase and the solution incubated for 1 hour at RT ...
-
bioRxiv - Microbiology 2022Quote: ... and 24 μg/ml of calcium pantothenate (Sigma, USA). Primary cultures were grown up to mid-log phase (0.6 OD595nm) ...
-
bioRxiv - Molecular Biology 2023Quote: ... extracted with phenol:chloroform:isoamyl alcohol (25:24:1, Sigma P3803), and resuspended in 65 μl H2O ...
-
bioRxiv - Microbiology 2023Quote: ... and 24 mg l-1 pantothenic acid (Sigma, P5155). Mycobacterium smegmatis (Msm ...
-
bioRxiv - Microbiology 2022Quote: ... 400 µl Phenol:Chloroform:IsoAmyl alcohol (25:24:1; Sigma Aldrich), and 500 mg autoclaved zirconia/silica beads (0.1mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... 400 μL phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma, 77617) were added to each sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... chloroquine (50 μM for 24 h, C6628, Sigma-Aldrich), or staurosporine (1μM for 3 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... before purification using Phenol:Chloroform:Isoamyl Alcohol 25:24:1 (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... chloroquine (10 or 25 μM, 24 h; Sigma-Aldrich) and/or MG132 (1 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... for 24 hours or with mimosine (0,5mM, Merck Millipore)/aphidicolin (400nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Endothelin-1 (100 nM, 24 hrs Sigma-Aldrich #E7764) was used to stimulate hypertrophy ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM sodium pyruvate (Sigma-Aldrich, #113–24–6), 1% non-essential amino acids (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM sodium pyruvate (Sigma-Aldrich, 113-24-6), 1% non-essential amino acids (Gibco ...