Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Treated embryos at 3 dpf were anesthetized with 0.025% aminobenzoic acid ethyl ester (tricane, Sigma), and amputated at the posterior edge of the notochord with a 1 mm sapphire blade (World Precision Instruments ...
-
bioRxiv - Cancer Biology 2024Quote: ... larvae were anesthetized in E3 water containing 0.2 mg/ml Tricaine (ethyl 3-aminobenzoate, Sigma). Larvae were maintained in E3 containing 0.2 mM N-phenylthiourea beginning 1 day post fertilization (dpf ...
-
bioRxiv - Microbiology 2023Quote: ... Larvae were anesthetized in E3 water (E3) + 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to all experiments ...
-
bioRxiv - Developmental Biology 2023Quote: The animals were anesthetized with 0.2% ethyl 3-aminobenzoate methanesulfonate salt (MS-222) (Sigma-Aldrich) for the limb amputation and sampling at various times thereafter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... they were anesthetized using 30 mg/L MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich). The skin tissue was taken from the right side near the back of each individual in approximately 0.8 × 1.0 cm under sterile conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... the zebrafish were anesthetized with 0.04% Tricaine (ethyl 3-aminobenzoate methanesulfonate salt, #A5040, Sigma, USA) in system water and given i.p ...
-
bioRxiv - Zoology 2024Quote: ... Worms were anesthetized in tricaine (15% ethyl 3-aminobenzoate, methanesulfonic acid salt; Sigma-Aldrich #E10521), and mounted on microscope slides with a 20×20 mm sticker grid with 1mm resolution (ThomasScientific ...
-
bioRxiv - Microbiology 2024Quote: ... larvae were anesthetized in E3 -MB containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma). For thermal injury and infection ...
-
bioRxiv - Cell Biology 2024Quote: ... Larvae were anesthetized in E3 water containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to experimental procedures ...
-
bioRxiv - Microbiology 2020Quote: ... 24 μg/mL adenine (Sigma), 0.4 μg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: 24) Cysteamine (Sigma, 30070-10G)
-
bioRxiv - Microbiology 2020Quote: ... 24 mM sodium bicarbonate (Sigma), 0.5% (wt/vol ...
-
bioRxiv - Immunology 2021Quote: ... 24 μM 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 24 µg/ml adenine (Sigma), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2023Quote: ... 24 µM 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 24 mg/l Pantothenate (Sigma) and 0.05% tyloxapol (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 24 µg/ml Adenine (Sigma) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Neuroscience 2024Quote: ... 24 mM NaHCO3 (Sigma, #S6014), 5 mM HEPES (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... 24 μg/ml adenine (Sigma), 8.4 ng/ml cholera toxin (Wako) ...
-
bioRxiv - Bioengineering 2024Quote: ... 24 μg/ml adenine (Sigma), 100 U/ml penicillin ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stained with freshly made Oil Red O solution (2 parts Milli-Q and 3 parts Oil Red O, Sigma Aldrich). Osteocytes were fixed with ice-cold 70% ethanol at 4°C and stained with freshly prepared supernatant of saturated Alizarin Red S (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 6–8-week-old C57BL/6N mice were anesthetized by inhalation of isoflurane (3–4%) or intraperitoneal injection of 2% Avertin solution (2,2,2-tribromoethyl alcohol dissolved in Tert-amylalcohol (Sigma)) dissolved in saline ...
-
bioRxiv - Cell Biology 2020Quote: ... or cellulose solution in N-hydroxysuccinimide (NHS; Aldrich; 100 mM) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma; 100 mM, 90 min, RT)44 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were treated for 24 h with 5 μg/ml Doxycyclin (Sigma, D9891) for induced expression of the Cre-recombinase from the Dox-inducible locus of A2lox WT cells to excise the loxP-flanked mT expression cassette and bring the mG expression cassette under the transcriptional control of the Rosa26 gene locus ...
-
bioRxiv - Neuroscience 2021Quote: ... The larvae were then optically cleared by replacing ethanol with ethyl cinnamate (ECi; Ethyl 3-phenyl-2-propenoate; Sigma-Aldrich, order no. 112372-100G). After 30-60 min of incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM ethyl pyruvate (Sigma #E47808), and 0.4 mM sodium ascorbate (Sigma #11140) ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... cells were plated on 24-well plates at 3x105 cells/well with 0.1 μg/mL 12-O-tetradecanoylphorbol-13-acetate (TPA, Sigma-Aldrich P1585) to promote differentiation ...
-
bioRxiv - Biophysics 2021Quote: ... in a 24-well (Starlab) in neuro basal medium supplemented with B27 (Gibco, Cat: 17504001, 25 × 10−3 М KCl (Sigma, Cat: P9541), 1× 10−3 М glutamine (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... 10 mL ATCC vitamin supplement and 1 mL vitamin K-3 solution (0.14 g vitamin K-3 in 100 mL 95% ethanol)24 reduced by the addition of 50% Oxyrase (SAE0013; Sigma, St. Louis, MO) were added in an anaerobic chamber ...
-
bioRxiv - Plant Biology 2020Quote: ... The absorbance of the reaction mixture was measured at 500 nm and the total flavan-3-ol content was calculated from a calibration curve prepared using (+)-catechin (Sigma-Aldrich) and expressed as milligrams per gram of dried extract ...
-
bioRxiv - Bioengineering 2023Quote: ... sections were stained with Oil Red O (3 mg/mL Oil Red O in 60% isopropanol; Sigma-Aldrich, St. Louis, MO, USA) for 6 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... tadpoles were rinsed in Evian and anaesthetized using Ethyl 3-aminobenzoate methanesulfonate salt (MS 222) (Sigma - CAS 886-86-2 ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Immunology 2020Quote: ... larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich). Simple tail transection of the caudal fin was performed using surgical blade (Feather ...
-
bioRxiv - Microbiology 2023Quote: ... larvae were anesthetized in E3-MB containing 0.2 mg/ml Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich). For prolonged time lapse imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... embryos were anaesthetized with 0.02% buffered 3-aminobenzoic acid ethyl ester (tricaine; Sigma-Aldrich, A-5040) in egg water.
-
bioRxiv - Microbiology 2024Quote: ... Embryos were anesthetized in E3 medium containing 0.02% buffered MS222 (Ethyl 3-aminobenzoate methane sulfonate (Sigma) during bacterial injections ...
-
bioRxiv - Bioengineering 2022Quote: ... crosslinking using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Carl Roth GmbH + Co. KG) and N-hydroxysuccinimide (NHS) (Sigma-Aldrich Chemie GmbH, Steinheim, Germany) was applied ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...