Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Tadpoles were briefly anesthetized with 0.1% MS-222 (ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich), and subsequently immobilized by immersion in a 10 μM α-bungarotoxin (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Newts were anesthetized in 0.1% (w/v) ethyl-3-aminobenzoate methanesulfonic acid (MS222; Sigma) dissolved in phosphate buffered saline ...
-
bioRxiv - Pathology 2021Quote: ... Larvae were anesthetised with 2.5% (v/v) ethyl-3-aminobenzoate methanesulfonate (tricaine) (Sigma, E10521), wounded posterior to the notochord using a sterile scalpel and kept in a 28°C incubator to recover as previously described 27 ...
-
bioRxiv - Neuroscience 2022Quote: ... larvae were anesthetized in 0.16mg/mL tricaine (ethyl 3-aminobenzoate methanesulfonate salt, Sigma-Aldrich) and loaded and oriented for imaging using an LPSampler and VAST BioImager fitted with a 600 μm capillary (Union Biometrica ...
-
bioRxiv - Physiology 2024Quote: ... male toads were anesthetized using ethyl 3-aminobenzoate methanesulfonate (MS-222; Sigma-Aldrich E10521) at a concentration of 1 g/L for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... BSA was coupled to the PEG (3000) for 1h at RT with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM, Sigma Aldrich, 39391) and N-hydroxy-succinimide (NHS ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2 (15 μg/mL) was immobilized on AR2G biosensors activated by 1-ethyl-3-[3-dimethylaminopropy] carbodiimide hydrochloride (EDC, E1769, Sigma, Shanghai, CHN) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Bioengineering 2020Quote: ... O,O′-bis[2-(N-succinimidyl-succinylamino)ethyl]polyethylene glycol with molecular weight of 2kDa (NHS-PEG-NHS, Sigma) was mixed with the protein solution at 10 w/w% ...
-
bioRxiv - Cancer Biology 2020Quote: ... Next day cells were incubated for 24 h with the virus-containing supernatant diluted in culture medium and 3 µg/mL Hexadimethrine bromide (polybrene, Sigma Aldrich). Afterwards medium was changed and after additional 24 h the medium was changed to selection medium containing 1 µg/mL puromycin (Puromycin dihydrochloride ...
-
bioRxiv - Cancer Biology 2020Quote: ... Next day cells were incubated for 24 h with the virus-containing supernatant diluted in culture medium and 3 µg/mL Hexadimethrine bromide (polybrene, Sigma Aldrich). Afterwards medium was changed and after additional 24 h the medium was changed to selection medium containing 1 µg/mL puromycin ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were treated for 24 hours with either 1 mM 3-Hydroxy-1,2-dimethyl-4(1H)-pyridone (Deferiprone/DFP, Sigma-Aldrich, 379409), or incubated in Earl’s balanced salt solution (EBSS ...
-
bioRxiv - Bioengineering 2021Quote: A1 reactive astrocytes were generated by culturing the purified astrocytes on PDMS coated tissue culture plates and then treating for 24 h with IL-1α (3 ng/ml, Sigma, I3901), TNF-α (30 ng/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then cleared by replacing ethanol with ethyl cinnamate (ECi; Ethyl 3-phenyl-2-propenoate; Sigma-Aldrich, order no. 112372-100G). After 30-60 min ...
-
bioRxiv - Synthetic Biology 2024Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...
-
bioRxiv - Neuroscience 2023Quote: 12 - 24 week old mice were euthanized by intraperitoneal injection of urethane (8mg/g of body weight, ethyl carbamate, Sigma Aldrich) followed by decapitation ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% o-cresolphthalein (Sigma), and 2% hydroxyquinoline (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% o-cresolphthalein (Sigma), and 2% hydroxyquinoline (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... or 100 pmol (third and fourth replicate) of the internal standard (22E)-Stigmasta-5,7,22-trien-3-beta-ol (Sigma-Aldrich, R202967) using 100 μl acetic anhydride/chloroform (1:12 v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Genomics 2021Quote: ... The larvae were then anaesthetized with 500 μM tricaine (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich) and livers were microdissected for RNA extraction.
-
bioRxiv - Physiology 2021Quote: ... Lungfish were anesthetized in freshwater containing 0.02% ethyl 3-aminobenzoate methane-sulfonate from Sigma-Aldrich, and tissue samples were quickly dissected and frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2021Quote: Larvae were anaesthetised in 0.6mM tricaine/MS-222 (ethyl 3-aminobenzoate methanesulfonate salt, Sigma Aldrich) in HEPES buffered E3 embryo medium and embedded in 1.3-1.5% (w/v ...
-
bioRxiv - Systems Biology 2021Quote: ... were anaesthetised in 0.5% solution of ethyl 3-aminobenzoate methanesulfonate (Sigma-Aldrich, St. Louis, MO) for 15 minutes to separate male and female worms ...
-
bioRxiv - Genomics 2020Quote: ... embryos were anesthetized by adding tricaine (MS222; ethyl-3-aminobenzoate methanesulfonate, #E10521-10G, Sigma-Aldrich) to the medium and selected by the internal positive control of transgenesis ...
-
Computational and functional characterization of the PI(4,5)P2 binding site of the TRPM3 ion channelbioRxiv - Biophysics 2022Quote: ... Frogs were anesthetized in 0.25% ethyl 3-aminobenzoate methanesulfonate solution pH 7.4 (MS222; Sigma-Aldrich), then bags of ovaries were surgically collected from and rotated with 0.1-0.3 mg/ml type 1A collagenase (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Lungfish were anesthetized in freshwater containing 0.02% ethyl 3-aminobenzoate methane-sulfonate from Sigma-Aldrich, and tissue samples were quickly dissected and frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Larvae were anesthetized in E3 water (E3) + 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to all experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... they were anesthetized using 30 mg/L MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich). The skin tissue was taken from the right side near the back of each individual in approximately 0.8 × 1.0 cm under sterile conditions ...