Labshake search
Citations for Millipore Sigma :
3601 - 3650 of 10000+ citations for Recombinant Human CD22 protein His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with anti-human Fab (Millipore Sigma) diluted 1:500 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated with 10 μg/ml Human Plasma Fibronectin (Sigma-Aldrich, FC010). Neurons were mechanically shaken off and removed by patting the flask approximately 2 days after inoculation ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Immunology 2023Quote: ... followed by injection of 6.5 U human chorionic gonadotropin (hCG; Sigma-Aldrich) 48 h later ...
-
bioRxiv - Cell Biology 2024Quote: Human retinal pigment epithelial (RPE) cells were cultured in DMEM (Sigma, #D5648) supplemented with 10% fetal bovine serum and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... and (2) the Human Cytokine 23-Plex Discovery Assay® (HD23; Millipore MILLIPLEX® Human Cytokine/Chemokine Magnetic Bead Panel II Immunology Multiplex Assay ...
-
bioRxiv - Microbiology 2024Quote: ... and then incubated with either (1) 20 µg human fibronectin (EMD Millipore); (2 ...
-
bioRxiv - Immunology 2024Quote: ... 5 distinct shRNAs directed against CD2AP encoding human CMS (shCMS) (Sigma-Aldrich Mission TRCN shRNA Target set ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 96-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C.
-
bioRxiv - Synthetic Biology 2024Quote: ... or 24-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Cell Biology 2020Quote: ... BAC clone (RP11-293M10) (CHORI) was fluorescently labeled using Cy3-dUTP (ENZO) and nick translation kit according to the manufacturer’s instructions (Sigma-Aldrich). Human Cot-1 (DNA ...
-
bioRxiv - Physiology 2019Quote: ... Conductance (G) was used to assess tight junction permeability and mucosal to serosal flux of 4KDa FITC-labeled dextran (Sigma) over time (sampled every 30 minutes for 2 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... These base media were then supplemented with 84 mg/mL 13C615N4 L-arginine plus 146 mg/mL 13C615N2 L-lysine or the corresponding non-labeled amino acids (all from Sigma) to generate either heavy or light media ...
-
bioRxiv - Neuroscience 2020Quote: Newly-born cells were labeled by the incorporation of synthetic thymidine analogues (XdU, Sigma Aldrich, Saint Louis, USA Table 1). In the first experiment ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were stained with primary antibodies diluted 1:1,000 in TTBS followed by incubation with horse peroxidase-labeled secondary antibody (Millipore Sigma) diluted 1:10,000 in 2% non-fat milk in TTBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Ten µl of the C18 SPE purified extracts were DMB-labeled with 60 µl of DMB labeling reagent (Sigma-Aldrich), at 50°C for 2.5 h in the dark under shaking conditions at 750 rpm (Hara et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... GABAergic neurons were labeled using anti-parvalbumin mouse antibody (PARV-19, 1:1000; Sigma, St. Louis, MO, USA, Product# P3088). All primary antibodies were diluted in goat serum (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The PKH26:MYH10-KD co-cultures 3T3-L1 cells were labeled with 0.5λ PKH26 Fluorescent Cell Linker Kit (Sigma-Aldrich); the GFP cells were added after one day.
-
bioRxiv - Biochemistry 2021Quote: ... or 680LT-conjugated anti-rabbit IgG (1:5000, Li-COR) and IRDye 800CW (Li-COR) labeled HPA (Helix pomatia lectin, Sigma) or PNA (peanut agglutinin ...
-
bioRxiv - Neuroscience 2020Quote: ... Synaptic varicosities were labeled with primary antibody for vesicular glutamate transporter 1 (vGluT1; 1:2000, 8 days incubation, Guinea Pig, MilliPore Biosciece Research Reagent ...
-
bioRxiv - Neuroscience 2021Quote: ... The DIG-labeled probes were hybridized to the membrane in Roche DIG Easy Hyb hybridization buffer (Millipore Sigma cat# 11603558001) at 49°C overnight ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were hybridized with labeled DNA probes (Supplementary Table S2) in the FISH Hybridization buffer (10% dextran sulfate (Sigma D8906) and 10% formamide in 2x SSC ...
-
bioRxiv - Cancer Biology 2022Quote: ... were coated with fluorescently labeled gelatin as previously described (31) or with 50 μg/ml poly-L-lysine (Sigma-Aldrich) for 20 min and let to air dry ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus was grown for 5 days at 37 °C and conidia were harvested and labeled fluorescein isothiocyanate (FITC; Sigma-Aldrich) or calcofluor white (CFW ...
-
bioRxiv - Cancer Biology 2022Quote: ... EV were labeled with a PKH67 dye labeling kit-green (or PKH26 dye labeling kit-red) following the manufacturer’s instructions (Sigma-Aldrich). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: Cy5-HA cryogels were synthesized with low- and high-DOS HA-Tz and incubated in 1mL of FITC-labeled 10µM diameter melamine resin micro particles (Sigma Aldrich) at 0.29mg/mL concentration on a rocker at room temperature overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Two bottles from each depth were labeled with 1mM Sodium bicarbonate-13C and 1mM Ammonium-15N chloride (Sigma-Aldrich, USA) and all 3 bottles (2 labelled and 1 control ...
-
bioRxiv - Neuroscience 2021Quote: ... The labeled samples were washed 3 times in PBT (10 min each) and incubated with DAPI (Sigma, cat. N. D9542) (5μg/ml ...