Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were cultured in medium supplemented with 2 mM 3-phosphoglycerate (3-PG, Sigma-Aldrich, #P8877) or 2 mM serine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary guide oligonucleotides (forward: 5’-CACCGCAGGATTGAAGACCTTAACA-3’; reverse: 5’-AAACTGTTAAGCTCTTCAATCCTGC-3’) were custom synthesized separately by Sigma-Aldrich (St. Louis, MO, USA), annealed ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Developmental Biology 2024Quote: The SHMT2 gene was cloned from cDNA of HeLa cells using primers 5’-GCCCATATGGCCATTCGGGCTCAGCAC-3’ (forward) and 5’-GCCCTCGAGATGCTCATCAAAACCAGGCA-3’ (reverse) and subcloned into the pET41a vector (Novagen, WI, USA) at restriction enzyme sites of NdeI and XhoI ...
-
bioRxiv - Developmental Biology 2024Quote: ... E10.5 embryos were incubated in 4-nitro blue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Sigma, 5655-25TAB) except when detecting Six1 and Mcrs1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Biochemistry 2021Quote: ... 6-Formylindolo[3,2-b]carbazole (FICZ) and 2-Methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) from Sigma-Aldrich. 1-HP ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM carbonyl cyanide 3-chlorophenylhydrazone (Sigma Cat # C2759) and 5 μM valinomycin (Sigma Cat # V0627) ...
-
bioRxiv - Genomics 2021Quote: ... a 3-day puromycin (5 μg/mL, Sigma, P8833) selection was performed 48 hours after the spin-inoculation ...
-
bioRxiv - Biophysics 2020Quote: ... mglBΔCT-R (5’-CGTAAAGCTTTTACACCAGGCTCTCGAAGATCTTCGTGAGCTC-3’ synthesized by Sigma-Aldrich, India ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’, Sigma-Aldrich) were mixed with 54 μl of RNAiMAX (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... moxidectin (3 nM) (Millipore Sigma, Catalog # 113507-06-5), ricobendazole (25 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the siRNA duplex 5′-UUCUCCGAACGUGUCACGUdTdT-3′ (Sigma). The cells were further processed according to the experimental design and depletion was assessed by immunofluorescence ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 nM Rab14 siRNA (5′-CAACUACUCUUACAUCUUU-3′, Sigma-Aldrich) for 72 h using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2023Quote: ... scrambled (NT) shRNA (5’-GCGATAGCGCTAATAATTT-3’ SHC202; Sigma-Aldrich) or a shRNA specific for human SOX11 (100% identity to the equine SOX11 sequence ...
-
bioRxiv - Microbiology 2024Quote: ... a 5% solution of 3-Aminopropyltriethoxysilane (APTES, Sigma-Aldrich) in tetrahydrofuran (THF ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Neuroscience 2022Quote: ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors were blocked using 6,7-dinitroquinoxaline-2,3-dione (DNQX, Sigma) dissolved in dimethyl sulfoxide and diluted by 1000 in aCSF for 10μM bath application.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Genetics 2023Quote: ... and 100µM 4-(3-butoxy-4-methoxy-benzyl) imidazolidone (Ro20-1724, Sigma Aldrich). IBMX and imidazolidone act as phosphodiesterase inhibitors ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... 3-deazauridine (3-DU) (Sigma Aldrich) was used as a non-selective inhibitor of CTPS1 and CTPS2.
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Neuroscience 2020Quote: ... 6–8-week-old C57BL/6N mice were anesthetized by inhalation of isoflurane (3–4%) or intraperitoneal injection of 2% Avertin solution (2,2,2-tribromoethyl alcohol dissolved in Tert-amylalcohol (Sigma)) dissolved in saline ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), for 1 hour at 4°C on rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine, Sigma) or a combination of all three (BCKAs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich), and incubated 10 min on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich), and sonicated using a fine probe (0.5-sec pulse at an amplitude of 20% ...
-
bioRxiv - Neuroscience 2021Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich) and sonicated using a fine probe (0.5-sec pulse at amplitude of 20% ...