Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP, Sigma Israel, B8503). In the foxd3/Rspo1 ISH experiment ...
-
bioRxiv - Microbiology 2021Quote: Stocks 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, Sigma-Aldritch) and 5-bromo-4-chloro-3-indolyl-phosphate disodium salt (X-P ...
-
bioRxiv - Microbiology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate disodium salt (X-P, Sigma-Aldritch) were made immediately before use by dissolving 20 mg of either compound in 1ml dimethylformamide (DMF ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (all Sigma-Aldrich, St. Louis, MO). Animals were mounted in 80% glycerol and imaged with a Zeiss Axiocam 506 Color camera mounted on a Zeiss Axio Zoom ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 0.35mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP Sigma Cat# B6149). Embryos were mounted in Permount™(BioWORLD Cat# 21750009).
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Plant Biology 2022Quote: ... 5-bromo-4-chloro-3’-indolyphosphate p-toluidine (BCIP) (Sigma-Aldrich catalog number B6149) staining was performed ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP, Sigma Israel, B8503). In the Snai2/RSPO1 ISH experiment ...
-
bioRxiv - Genomics 2023Quote: ... we treated 3 x 105 cells with 5 μM 4-hydroxytamoxifen (Sigma Aldrich #T176) for 24 h ...
-
Metabolomics reveals nucleoside analogs for regulating mucosal-associated invariant T cell responsesbioRxiv - Immunology 2023Quote: ... and substrates 5-bromo-4-chloro-3’-indolyphosphate/nitro-blue tetrazolium (BCIP/NBT, Sigma). We used CTL-ImmunoSpot S6 Micro Analyzer to visualize and quantify IFNγ+ MAIT cell spots ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cell Biology 2022Quote: ... Triple Dynamin (Dyn1/2/3) knockout was induced by 1 μM 4-hydroxytamoxifen (Sigma) as previously described44 ...
-
bioRxiv - Developmental Biology 2021Quote: 3-4 nl of 2 mg per mL Rhodamine B isothiocyanate-Dextran (70kDa, Sigma) dissolved in PBS and 5 mM HEPES were injected into the sinus venosus of 30 hpf embryos ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2’,3’-cGAMP (CAS no. 1441190-66-4) were obtained from Sigma-Aldrich and used without further purification.
-
bioRxiv - Genomics 2020Quote: ... 3 million CD4+ T cells were incubated in the presence of 5,6-Dichloro-1-β-D-ribofuranosylbenzimidazole (DRB, Sigma-Aldrich, Cat: D1916) at a final concentration of 65μM or Triptolide (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Molecular Biology 2024Quote: ... The number of viable cells was determined by mitochondrial conversion of 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma Aldrich, Missouri, USA) to formazan ...
-
bioRxiv - Bioengineering 2023Quote: The mice were anaesthetized with isoflurane (induction 5%, maintenance 2−3%; Sigma-Aldrich, USA) and secured in a stereotaxic instrument (RWD ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-ODibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Stock solutions: 50 mg/ml 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma B8503) in 100% dimethylformamide (Sigma D4254 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) is added in ACSF to enhance the Ca2+ signals ...
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Microbiology 2024Quote: Sulfamethoxazole (IUPAC: 4-Amino-N-(5-methylisoxazol-3-yl)-benzenesulfonamide) was purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...