Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 μg/mL + 7 μg/mL FRD+U (5-Fluoro-2′-deoxyuridine, Sigma-Aldrich, Cat# F0503 and Uridine ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Developmental Biology 2024Quote: ... Staining was detected with 5-bromo-4-chloro-3’-indolylphosphate/nitro-blue-tetrazolium (BCIP/NBT, Sigma).
-
bioRxiv - Molecular Biology 2021Quote: ... X0-3 and X0-4 oligonucleotides (Sigma-Aldrich) in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µM 4-hydroxytamoxifen (OH-Tam, Sigma Aldrich) was added to induce Cre-mediated recombination in the mouse Ctsd gene resulting in a premature stop codon ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 ng/mL human NT-3 (Sigma-Aldrich), and 1 μg/mL laminin (Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM glyceraldehyde-3-phosphate (G3P; Sigma-Aldrich), 4 mM nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Neuroscience 2024Quote: ... odors (4-methylcyclohexanol or 3-octanol; Sigma-Aldrich) were delivered through an air-flow that was held stable at 0.750L per minute ...
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4) the substrate solution (nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, Sigma-Aldrich, St. Louis, MO). Other details were as described previously [Duk M. ...
-
bioRxiv - Plant Biology 2024Quote: ... AGPs were finally detected using the following substrates: 4 mg of 5-bromo-4-chloro-3-indolylphosphate (BCiP; Sigma, USA) in 1 mL water and 9 mg of nitro-blue tetrazolium (NBT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were washed 3 times with 200mL NM containing 2% L-cystein (Millipore, #52-90-4), pH 7.5 ...
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated media and flowthrough media were frozen at −80°C.
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated medium and flowthrough medium were frozen at −80°C.
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were dehydrated in increasing concentrations of ethanol for 5 min each (2 × 35%, 50%, 70%, 80%, 90%, 3 × 100%) and washed 3 x 5 min with propylene oxide (Sigma- Aldrich, #cat 110205-18L-C). Sections were next embedded overnight at RT in Durcupan resin (20g component A ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were placed into 1/3 Methanol and 2/3 dichloromethane (DCM, Sigma-Aldrich, 270997) with rotation at 13rpm at room temperature for overnight incubation ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Immunology 2023Quote: ... the nitrofen group was administered 100mg of nitrofen (2,4-dichloro-4’-nitrodiphenyl ether, Sigma-Aldrich) in 1mL of olive oil via intragastric administration 16 ...