Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SC-Leu-Trp-His +5 mM 3-AT (3-Amino-1,2,4-triazole, Sigma, 18056-25G). Plates were incubated at 30°C and imaged daily for at least three days.
-
bioRxiv - Cell Biology 2021Quote: ... Skin was minced into small pieces (about 2-3 mm × 2-3 mm) and digested by incubation with 1 mg/mL collagenase V (Sigma) in PBS for one hour with shaking (250 rpm) ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Chemical compounds were first identified using the NIST library and later confirmed with co-elution of synthetic 4-methyl-3-heptanone (Pfaltz and Bauer M19160) and 4-methyl-3-heptanol (Sigma Aldrich M48309). Compounds eluting after 30 minutes were excluded from the analysis due to lack of volatility.
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Phosphatase Inhibitor Cocktail 2 and 3 (Sigma-Aldrich)] ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitor 2 and 3 cocktail (Sigma) as previously described (26).1 μg/μl protein lysates in Laemmli sample buffer supplemented with 0.025 M DTT were boiled for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... with TM (2-3 mg/pregnant female) (Sigma) dissolved in corn oil (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates were incubated at 4°C for 30 minutes and supernatants were collected after centrifugation at 20,000xG at 4°C for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... 1% phosphatase inhibitor cocktails 2 and 3 (SIGMA), 1% IGEPAL ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) blocked in 2% Bovine Serum Albumin (Sigma) in PBS with permeabilization by 0.2% Triton X-100 (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 3 mM Mg(Ac)2 (Sigma-Aldrich, M5661), 10 mM Tris pH 7.8 (Invitrogen ...
-
Large-scale conformational changes of FhaC provide insights into the two-partner secretion mechanismbioRxiv - Biophysics 2022Quote: ... 3 mM tris(2-carboxyethyl)phosphine (TCEP, Sigma) was added to the detergent extract before ion exchange chromatography ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 (P5726) and 3 (P0044) from Sigma-Aldrich, St ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 (P5726) and 3 (P0044) from Sigma-Aldrich, St ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3′-dA (Sigma, 2 mM final concentration) were dissolved in G1.5 medium (Vitrolife) ...
-
bioRxiv - Immunology 2020Quote: ... and 2 mg Al(OH)3 (alum, Sigma) in saline on D0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphatase inhibitor 2 and 3 cocktail (Sigma-Aldrich), 2.5 mM MgCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) to release membrane proteins ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma)) and incubated on ice for 60 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) and precipitated proteins were eluted with 4x SDS sample buffer at 95 °C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml 3-5kDa fluorescein dextran (Sigma) in 50% CM with 10 μM Y-27632 ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Benzonase (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% Phosphatase Inhibitor Cocktail 2 and 3 (Sigma), and 10 mM sodium butyrate) ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2% Phosphatase inhibitor cocktail 3 (Sigma-Aldrich)] ...
-
bioRxiv - Cell Biology 2023Quote: ... EHMT1/2 inhibitor (Sigma-Aldrich, 3 mg/mL), SB747651A ...
-
bioRxiv - Cell Biology 2022Quote: ... and Phosphatase inhibitors cocktail 2 and 3 (Sigma). Lysed cells were harvested by scraping ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma) and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma). Benzonase (Millipore ...
-
bioRxiv - Microbiology 2023Quote: Cinnamaldehyde (CAD) (3-Phenylprop-2-enal; Sigma-Aldrich) minimum inhibitory concentration (MIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Sodium 3-methyl -2-oxobutyrate (KIV) (Sigma) were used to prepare branched-chain ketoacid (BCKA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitors (cocktail 2 and 3, Sigma). Samples were then sonicate for 1 minute and a BCA assay was used to determine the protein concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitors cocktail 2 and 3 (Sigma) one ice for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitors cocktail 2 and 3 (Sigma). The cells were lysed for 30 to 45 minutes at 4°C followed by centrifugation at 14000 RPM for 40 minutes at 4°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and (3) 4- methylmorpholine (4.5 equiv:ELP amine; Sigma, M56557). The reagents are dissolved at room temperature (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... 1-octen-3-ol (Sigma CAS #3391-86-4), 2,3-butanedione (Sigma CAS #431-03-8) ...
-
bioRxiv - Developmental Biology 2022Quote: ... CHIR99021 [3 µM] and 4.5x10-4 M Monothioglycerol (Sigma). On day 2 ...