Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Neuroscience 2021Quote: ... 158 mg dichloro-methylene diphosphonate (clodronate; Sigma-Aldrich) dissolved in sterile PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 158 mg dichloro-methylene diphosphonate (clodronate; Sigma-Aldrich) dissolved sterile PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... 158 mg dichloro-methylene diphosphonate (clodronate; Sigma-Aldrich) dissolved sterile PBS (pH 7.4 ...
-
bioRxiv - Genetics 2021Quote: ... 3 mM MgCl2 (Sigma, 7786-30-3), 0.1% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and EIF4E2 shRNA#3 (sh4EHP#3) (Sigma,). GIGYF2 shRNA#1 (shGIGYF2#1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... covered with 3-aminopropyltrimethoxysilane (3-APTS, Sigma) for 3 min for activation ...
-
bioRxiv - Neuroscience 2021Quote: ... oxygenated DAB (3-3’-diaminobenzidine, Sigma-Aldrich) was dissolved in 0.1 N HCl at a concentration of 5.4 mg/ml and subsequently diluted ten-fold into sodium cacodylate buffer (pH 7.4 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3-mercaptobenzoic acid (3-MBA, Sigma-Aldrich)-capped gold nanoclusters (3-MBA-Au nanoclusters ...
-
bioRxiv - Biochemistry 2024Quote: ... 3% SDS (Sigma-Aldrich, 151-21-3), 25 mM β-glycerophosphate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... ultracel-3 (>3 kDa cutoff) concentrators (Millipore). 30 µl of concentrate was loaded for western blot analysis.
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... 2% SDS) supplemented with protease inhibitor and phosphatase inhibitors 2 and 3 (Sigma). Samples were subjected to dounce homogenization ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with 500 µL of 2% 3-aminopropyltriethoxysilane (Sigma; 919-30-2) in 95% ethanol for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Genetics 2024Quote: ... Positive interactions were scored by the appearance of white-coloured colonies on a synthetic defined medium containing 6 µg mL-1 adenine and/ or by the growth in the presence of 2 mM 3-Amino-1,2,4-triazole (3-AT) (Cat. No. A8056, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: ... Sesamol and 3′,4′-(Methylenedioxy) acetophenone were purchased from Sigma-Aldrich. All the analytical grade chemicals were procured from Merck Limited ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 mM EDTA was replaced with 4 mM ATP (Sigma, A7699) and 1 mM magnesium acetate where indicated ...
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... propyl acetate and 3-methyl-2-buten-1-ol (Sigma). Odorants were selected based on previous work using this task (Gu & Li ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... as above and phosphatase inhibitors (Cocktails 2 and 3, Sigma). Proteins were quantified by Bradford assay (Biorad) ...
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Cell Biology 2021Quote: ... 1/100 Phosphatase Inhibitor Cocktail 2 and 3 (Sigma Aldrich). Per condition ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-Akt 1/2/3 antibody (Millipore, Burlington, MA), rabbit anti-MAPK family antibodies (Cell Signaling Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... and 100 μl Phosphatase Inhibitor Cocktail 2 & 3 (Millipore Sigma). Aliquots of lysates were saved for further analyses as total homogenates ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, Switzerland). Sequential biochemical fractionation of cell extracts was performed as described previously31,34,69 ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland). The cells in suspension were then incubated for 15 min on ice before being lysed mechanically using a Dounce homogenizer (with type B pestle) ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland) and boiled for 10 min as previously described34.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma Aldrich) and protease inhibitor (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... and then 3 μL of 2% Evans Blue (Sigma-Aldrich) was injected into the right later ventricle (AP ...