Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... were blocked with 3% fatty acid free BSA (#A7030, Sigma) in TBS for 1-2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 750 µM indole-3-acetic acid sodium salt (IAA, Sigma) was supplemented to the medium and cells were incubated for the indicated time points before harvest.
-
bioRxiv - Microbiology 2023Quote: ... - 3-benzenedisulfonic acid (Tiron) and Bicyclomycin were purchased from Sigma.
-
bioRxiv - Bioengineering 2023Quote: ... in 3% v/v aqueous acetic acid (A6283, Sigma-Aldrich) solution for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: For the auxin (3-indole acetic acid, Sigma # I2886, USA) mediated protein degradation ...
-
bioRxiv - Genomics 2023Quote: ... and 0.5 mM indole-3-acetic acid (IAA, Sigma, I5148) and cells were refreshed every 2-3 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis (succinimidyl succinate ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Immunology 2024Quote: ... and 15 acid-washed 3-mm glass beads (Sigma-Aldrich). Total RNA was isolated from a volume of lung homogenate equivalent to 30 mg of tissue using the RNeasy Tissue Kit and RNase-Free DNase Set (both Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors were blocked using 6,7-dinitroquinoxaline-2,3-dione (DNQX, Sigma) dissolved in dimethyl sulfoxide and diluted by 1000 in aCSF for 10μM bath application.
-
bioRxiv - Neuroscience 2021Quote: ... [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Neuroscience 2021Quote: ... [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Neuroscience 2022Quote: ... the 3:1-DMEM/F12-medium was supplemented with 10 μM retinoic acid (Sigma, #R2625), and the medium was daily exchanged ...
-
bioRxiv - Plant Biology 2024Quote: ... spores were sown directly on plates supplemented with Indole-3-acetic acid (IAA; Alfa aeser) or 1-Naphthaleneacetic Acid (NAA, Sigma). Size measurements were done when plants reached sexual maturity (±6/7 days) ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Imaging buffer containing 2 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox, Sigma), 5mM 3,4-Dihydroxybenzoic acid (DBA ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1 mM Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Sigma, Cat# 238813). The cultures were kept at 35 °C during the imaging procedure ...
-
bioRxiv - Biophysics 2024Quote: ... Twelve mM Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma-Aldrich; 238813-1G) solution was prepared as described previously3 by adding 60 mg of Trolox (238813-5G ...
-
bioRxiv - Biophysics 2024Quote: ... and 1.5 mM 6-hydroxy-2,5,7,8-tetramethyl-chromane-2-carboxylic acid (Trolox, Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... MICAL1#2 (5′CUCGGUGCUAAGAAGUUCU[dU][dU]3′) (75) and Rab35 (5′GCUCACGAAGAACAGUAAA[dU][dU]3′) (76) were synthetized by Sigma.
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2024Quote: ... 15 mM 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (Millipore Sigma E6383), 5 mM N-hydroxysuccinimide (NHS ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Immunology 2020Quote: ... 50 μl of antibody exposed to hemin or hemin in PBS only were mixed with 150 μl of reaction buffer (0.15 M citrate-phosphate buffer pH 5) containing 0.9 mM of 2,2-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma-Aldrich) and 6 mM H2O2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SC-Leu-Trp-His +5 mM 3-AT (3-Amino-1,2,4-triazole, Sigma, 18056-25G). Plates were incubated at 30°C and imaged daily for at least three days.