Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 50 µL of media was extracted with 450 µL 3:1:0.004 (v/v/v) acetonitrile:methanol:formic acid + 10 nM verapamil (V105, Millipore Sigma) as an internal standard ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Phase 3 (S3, 2 days): S3 medium + 50 ng/mL FGF7 + 1 μM retinoic acid (Sigma, Cat# R2625) + 0.25 μM SANT-1 (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phenol acid chloroform 5:1 (Sigma-Aldrich) and NaCl 10 mM were then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phenol acid chloroform (5:1; Sigma-Aldrich) and 10 mM NaCl were subsequently added to the samples ...
-
bioRxiv - Cell Biology 2021Quote: A 10 mM oleic acid stock solution was made in 3 mM fatty acid–free BSA (Millipore-Sigma)-PBS ...
-
bioRxiv - Cell Biology 2021Quote: A 10 mM oleic acid stock solution was made in 3 mM fatty acid–free BSA (Millipore-Sigma)-PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... slides were stained in Phosphomolybdic Acid / Phosphotungstic Acid mix (Sigma-Aldrich, product number HT15-3 and HT15-2) for 7 minutes and in Aniline Blue Solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX, Sigma), 1 mM DTT (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% DMSO and 300 μM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (MBS; Sigma) dissolved in microtubule stabilization buffer specific for algae (MTB ...
-
bioRxiv - Genomics 2020Quote: ... before addition of 500 μM indole-3-acetic acid solution (“auxin”, Sigma-Aldrich) for different times to induce RPB1 degradation ...
-
bioRxiv - Genomics 2020Quote: ... To the XRN1-AID strain 0.2mM of auxin (3-Indoleacetic acid; Sigma-Aldrich) was added to the media 30 and 60 minutes before harvesting ...
-
bioRxiv - Cell Biology 2021Quote: ... were treated with 500μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) to induce degradation of the desired AID-tagged target protein ...
-
bioRxiv - Biophysics 2020Quote: ... 4.5% acetic acid and 2.5% 3-(triethoxysilyl)-propylamine (EMD Millipore Corp., Billerica, MA), rinsed with methanol and water and finally dried under a stream of nitrogen (63) ...
-
bioRxiv - Physiology 2022Quote: Auxin plates were prepared by adding auxin indole-3-acetic acid (Sigma-Aldrich) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 3 dpf MD zebrafish were soaked in 25 μg/mL lipoteichoic acid (Sigma) or 25 μg/mL peptidoglycan (Sigma).
-
bioRxiv - Cell Biology 2020Quote: ... cultures were supplemented with auxin (Indole-3-acetic acid sodium salt, Sigma I5948) to final concentrations of 500 µM ...
-
bioRxiv - Bioengineering 2020Quote: ... MMP-3 was activated in 0.1 mM P-Aminophenylmercuric acid (#164610, Milipore Sigma) at 37 °C for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... acidified to a final concentration of 0.5% trifluoroacetic acid (pH < 3, Sigma, AAA1219822) and desalted by reversed phase C18 solid phase extraction (SPE ...
-
bioRxiv - Biochemistry 2023Quote: ... prepared in 3% (v/v) nitric acid (≥99.999% trace metals basis, Sigma-Aldrich). An internal standard solution (3% (v/v ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-indolylacetyl)-DL-aspartic acid (IAA-Asp; Sigma-Aldrich, St. Louis, MO), (+/-)-jasmonic acid (JA ...
-
bioRxiv - Cell Biology 2024Quote: ... Strips were blocked with 3% fatty acid–free bovine serum albumin (BSA; Sigma) in TBS-T (10 mM Tris–HCl pH 8.0 ...
-
bioRxiv - Genomics 2024Quote: ... but with SCD-Ura supplemented with indole-3-acetic acid (IAA, Sigma I2886) to 0.5 mM.
-
bioRxiv - Microbiology 2024Quote: ... 30 mM 3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, Product No. 69947) was used as a buffering agent at pH at 7 during the experimental time course ...
-
bioRxiv - Immunology 2023Quote: ... and developed using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) substrate (Sigma). All antibodies are listed in Table S5.
-
bioRxiv - Bioengineering 2023Quote: ... the larvae were anesthetized with tricaine (3-aminobenzoic acid ethyl ester, Sigma Aldrich) and immobilized in 1% low-melting-point agarose inside a fluorinated ethylene propylene tube for further imaging.
-
bioRxiv - Molecular Biology 2023Quote: ... 8 mM of the auxin 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added to the arrested cells 1 h prior to generating DSBs.
-
bioRxiv - Genomics 2022Quote: ... before addition of 500 µM indole-3-acetic acid solution (“auxin”, Sigma-Aldrich) for 14 h to induce RPB1 degradation ...
-
bioRxiv - Physiology 2022Quote: ... Ketones used for all experiments were (R)-3-Hydroxybutyric acid (Sigma-Aldrich #54920). Citrate used for all experiments was sodium citrate (Sigma-Aldrich #1613859) ...
-
bioRxiv - Neuroscience 2022Quote: ... buffered with 3 mM N-2-hydroxyethylpiperazine-N’-ethanesulfonic acid (HEPES, Sigma Chemical) and pH adjusted to 7.65 at 15°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... mice were treated with 30 mg/kg 3-Mercaptopropionic acid (M5801, Sigma-Aldrich) by gavage in combination with 1 mg/kg 3-DZNeP ...