Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Cell Biology 2022Quote: ... 14-3-3 (Millipore AB9748-I, 1:2000); TOPO II (Abcam 109524 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mL of 1% alcian blue in 3% acetic acid (Sigma-Aldrich, B8438), and 10 mL water was prepared ...
-
bioRxiv - Biophysics 2023Quote: ... Solutions contained ∼1 mM 3-(Trimethylsilyl)propionic-2,2,3,3-d4 acid (TMSP, Sigma-Aldrich) as a frequency reference.
-
Co-release of GABA and ACh from medial olivocochlear neurons fine tunes cochlear efferent inhibitionbioRxiv - Physiology 2024Quote: ... and (3) mouse anti-glutamic acid decarboxylase (GAD-6) (1:500;MAB351R, Millipore) to label GABAergic cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: 6-(5-Pyrazolyl)pyridine-2-carboxylic acid (0.1 mM, Accela ChemBio Inc.) in dry N,N-Dimethylformamide (DMF) (Sigma Aldrich) was dissolved and stirred with N,N’-Dicyclohexylcarbodiimide (DCC ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine, Sigma) or a combination of all three (BCKAs) ...
-
bioRxiv - Plant Biology 2022Quote: Indole-3-acetic acid (IAA, 10 μM; Sigma-Aldrich) and (+/-)-abscisic acid (ABA ...
-
bioRxiv - Molecular Biology 2020Quote: Indole-3-acetic acid sodium salt (Sigma I5148-2G) was dissolved in water to 500 mM ...
-
bioRxiv - Microbiology 2020Quote: ... 50 μM 3-(3,4-dihydroxyphenyl)propionic acid (102601, Sigma) or H2O as control ...
-
bioRxiv - Microbiology 2020Quote: ... acidified to pH ~3 using 100% formic acid (Sigma). No bacterial consortium control was used because the consortium stock culture was free of carbon and would not survive ...
-
bioRxiv - Systems Biology 2020Quote: ... For amino acid derivation 3 μL phthaldialdehyde (Sigma-Aldrich), i.e ...
-
bioRxiv - Cell Biology 2022Quote: ... At indicated times auxin (3-indolo acetic acid, Sigma) was added at a final concentration of 1-2.5 mM (table S4) ...
-
bioRxiv - Genetics 2022Quote: ... Auxin (3-indole acetic acid; Sigma-Aldrich Catalogue # I3705) was added to SC minimal media with 300 uM final concentration in DMSO ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM Phospho(enol)pyruvic acid (PEP; Sigma, P0564), 0.25 mM β-NADH (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... by using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma). These cross-linked peptides were used to immunize rabbits ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 mM formic acid pH 3 (Sigma-Aldrich F0507), 50% methanol (Honeywell LC230-4) ...
-
bioRxiv - Genetics 2020Quote: 70 mg of Auxin (3-Indoleacetic acid, Sigma #I3750) were dissolved in 10 ml DMSO to yield a 40 mM stock solution and stored at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 3-methyl-benzoate (3MB, m-toluic acid, Sigma T36609), was used at a concentration of 1mM ...
-
bioRxiv - Neuroscience 2023Quote: ... and Kainic acid (10 μM, Sigma #58002-62-3). The working dilution was directly added to the wells during MEA recordings ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 mM valproic acid sodium salt (Sigma-Aldrich) were added to the cells to enhance protein expression ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 µM auxin (indole-3-acetic acid; Sigma Aldrich) dissolved in DMSO was top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150 µL of 3 M perchloric acid (Sigma, 244252) was added to each well and immediately covered with phenylethylamine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... by using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma). These cross-linked peptides were used to immunize rabbits ...
-
bioRxiv - Biophysics 2022Quote: Powder form of 3-sn-phosphatidic acid (Sigma Aldrich), Brain phosphatidylserine (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μM auxin (indole-3-acetic acid; Sigma-Aldrich) dissolved in DMSO was added to liquid media or top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Genetics 2022Quote: ... Auxin (3-indoleacetic acid) (Sigma-Aldrich, St. Louis, MO) was made as a 1M stock in DMSO then added to 500μM or 750μM final concentration in liquid media or plates ...
-
bioRxiv - Plant Biology 2024Quote: 3-Indoleacetic acid (IAA) was purchased from Sigma-Aldrich. The stock solution was prepared using dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-(maleimido)propionic acid N-hydroxysuccinimide ester (Sigma). For co-grafted brushes ...
-
bioRxiv - Microbiology 2022Quote: ... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
bioRxiv - Plant Biology 2020Quote: ... 2.60 g/L phytagel (pH 5.8) with/without 10 μM 1-aminocyclopropane-1-carboxylic acid (ACC) (Sigma, CA, USA), and grown under dark conditions at 25 °C ...