Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Auxin 3-Indoleacetic acid (IAA) (Sigma-Aldrich) was dissolved in ethanol to prepare a 57 mM stock solution and stored at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... indole-3-acetic acid (IAA, Sigma-Aldrich) (1 mg L-1 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
bioRxiv - Cell Biology 2024Quote: ... two siRNA sequences targeting different regions of NOK were designed as #1: 5’-GCAAGAAACAUUCAUGCAU-3’ and #2: 5’-GUCUUUCCCAGGGACACAA-3’ (SASI_Hs01_00043410 and SASI_Hs02_00351937, Sigma, St. Louis, MO, USA). The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 mM (±)-6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; 238813-5G, Sigma-Aldrich). To obtain images for training the DeepSTORM model ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) was initially added in HBSS buffer to enhance baseline Ca2+ signals ...
-
bioRxiv - Neuroscience 2023Quote: ... acid-sensing ion channel 3 (guinea pig anti-ASIC3, Millipore; 1:2000), S100β (rabbit anti- S100β ...
-
bioRxiv - Microbiology 2023Quote: ... with 3-(trimethylsilyl)-1-propanesulfonic acid sodium salt (DSS, 178837, Sigma Aldrich) as internal standard ...
-
bioRxiv - Plant Biology 2020Quote: ... Trolox® (6- hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma-Aldrich) solutions of known concentration ...
-
bioRxiv - Plant Biology 2020Quote: ... DL-2-piperidine-d9 carboxylic acid (D9-Pip; Sigma-Aldrich 688444) was co-infiltrated at a final concentration of 2 mM as part of the final bacterial suspension or Mock-solution ...
-
bioRxiv - Biophysics 2023Quote: ... Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid; Sigma #238813-1G) was dissolved in 3.2 mL of HPLC grade water ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM 6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Sigma, 238813), 250 µg/ml glucose oxidase (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protocatechuic acid (PCA) and 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox) (both Sigma-Aldrich), and was used for imaging of cohesin ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Indole-3-acetic acid (IAA, auxin) (I5148; Sigma) was dissolved in ddH2O and used at a final concentration of 500 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... (R)-(-)-3-hydroxybutyric acid sodium salt (Sigma 298360) was added to the culture media at the indicated concentrations ...
-
bioRxiv - Biochemistry 2020Quote: ... Indole-3-acetic acid (IAA; Sigma, catalog #I5148) was added to the medium at 500 μM overnight.
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA; Sigma-Aldrich, I3750), dissolved in DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... in 3% (v/v) acetic acid (Sigma-Aldrich) solution for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... 3 units of D-amino acid oxidase (Sigma), 6 units of horseradish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 μM indole-3-acetic acid (Sigma-Aldrich) was used as auxin in the AID-BCY1 experiments.
-
bioRxiv - Cell Biology 2022Quote: ... 100 µM IAA (3-Indole Acetic Acid, Sigma I2886 ...
-
bioRxiv - Immunology 2023Quote: ... in 3% acetic acid (Sigma-Aldrich, pH 2.5) for 5 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... indole-3-acetic-acid (auxin) (Sigma Aldrich, I5148) was added to a final concentration of 500 µM 14 h after the second release ...
-
bioRxiv - Genomics 2023Quote: ... indole-3-acetic acid (IAA) (Sigma-Aldrich #12886) was injected into the growth chamber and media reservoir to achieve a final concentration of 500 µM ...
-
bioRxiv - Immunology 2024Quote: ... and 3 mM of valproic acid (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... 3 uM Oleic Acid (Cat# 03008; Sigma-Aldrich) was applied overnight to iMGLs ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 3 ml propionic acid (Sigma-Aldrich #P5561), per litre of medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... DL-indole-3-lactic acid (Sigma Cat#I5508), tryptophan and indole-3-acetic acid ...
-
bioRxiv - Bioengineering 2024Quote: ... p-hydroxyphenyl acid (pOHPAA; 1.0e-3 M, Sigma), in 0.25 M Tris buffer (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Bioengineering 2020Quote: ... were added to 1 mL of a 0.1M solution of 5-norbornene-2-carboxylic acid in 0.1M phosphate buffer (pH 6.0) (all reagents purchased from Sigma-Aldrich). The solution was allowed to react at room temperature with intermittent vortexing ...
-
bioRxiv - Bioengineering 2023Quote: ... Di-tert-butyl decarbonate (BoC2O) and 5-norbornene-2-carboxylic acid were purchased from Sigma Aldrich (St. Louis, MO). Irgacure 2959 was purchased from Advanced Biomatrix (Carlsbad ...
-
bioRxiv - Cancer Biology 2021Quote: ... oxidative stress was reduced with 1 mM Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma). For all the inhibitor experiments ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... indole-3-propionic acid (order no. 57400) and indole-3-butyric acid (order no. i5386) have been obtained from Sigma-Aldrich. All ligands have been dissolved in 50mM Tris / 300mM NaCl pH8 buffer with if necessary 1% dimethyl-sulfoxide (DMSO) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...