Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 3 mg/mL hyaluronic acid sodium salt (HyA, 53747, Sigma-Aldrich, MO), and 0.25% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... centrifuged at 17000 rpm and the supernatant was mixed with cold trichloroacetic acid (v:v = 3:1, Sigma). Samples were incubated at −20 °C for 2 h ...
-
bioRxiv - Plant Biology 2021Quote: ... 600 μl 4% acetic acid with 20 μl 1mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX, Sigma) and 0.6 μl 1mM spike control 8-Br-2′,3′-cAMP (Biolog ...
-
bioRxiv - Microbiology 2022Quote: ... XTT (sodium 3′- [1- (phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4- methoxy6-nitro) benzene sulfonic acid hydrate) (Sigma-Aldrich), according to the manufacturer’s recommended specifications ...
-
bioRxiv - Neuroscience 2024Quote: Cell pellets from day 65 neuronal cultures were digested in 1 ml of 3 % Nitric acid (Millipore) on a shaker at 85°C overnight followed by an incubation of 2 h at 95°C the following day ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 0.8 mL 3:1:0.004 acetonitrile:methanol:formic acid + 10 nM verapamil (V105, Millipore Sigma) or 10 nM clarithromycin (A3487 ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mg/mL 5-FOA (5-Fluoroorotic acid, Sigma) was added to the selection plates ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.7 g (8.9 mmol) 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDAC, Sigma Aldrich), and 1.2 g (8.9 mmol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 0.1 mg/ml, Sigma-Aldrich). Gels were rinsed 3 times with milli-Q water and dried in the oven for 15 min at 60 °C ...
-
bioRxiv - Immunology 2020Quote: ... containing 0.25% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Biophysics 2023Quote: ... and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDC) were purchased from Sigma Aldrich Corp ...
-
bioRxiv - Immunology 2024Quote: ... 1mL of 50 mg/mL 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Sigma) in PBS was added ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Plant Biology 2024Quote: ... The media was supplemented with filter-sterilized (.22 μm) L-azetidine-2-carboxylic acid (Aze, Sigma) or other amino acids of varying concentrations as defined in the figure legends ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... 3-deazauridine (3-DU) (Sigma Aldrich) was used as a non-selective inhibitor of CTPS1 and CTPS2.
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... a 50:50 mixture of ALI x2 media (Airway Epithelial Cell Basal Medium with 2 supplement packs added (without triiodo-L-thyronine and retinoic acid supplements) and 1 ml BSA (3 µg/ml)) and DMEM supplemented with retinoic acid (15 ng/ml) (Sigma Aldrich, Gillingham, UK). Cells were fed apically and basolaterally until 100% confluent ...
-
bioRxiv - Microbiology 2021Quote: ... or the same isosmotic solution with 100 µM of the general anion channel inhibitor 5-Nitro-2-(3-phenylpropylamino) benzoic acid (NPPB, Sigma-Aldrich), which inhibits malarial new permeation pathways (59) ...
-
bioRxiv - Microbiology 2023Quote: Cross-linking experiments were performed by incubation of 2 mM and 5 mM of suberic-bis-acid ester (3-sulfo-N-hydroxyuccinimy (BS3, Sigma-Aldrich) with the purified recombinant protein in 25 mM sodium phosphate pH 7.4 for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... Flash-frozen plant samples (0.2 g) were ground and extracted using 2 mL of 3 % 5-sulfosalicylic acid (Sigma, ON, Canada). The extract was centrifuged for 10 min at 8050 x g at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Systems Biology 2022Quote: ... 1-3 grams of lysozyme (Sigma)
-
bioRxiv - Immunology 2022Quote: ... and 1-bromo-3-chloropropane (Sigma). cDNA was synthetized using SuperScript™ III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM 3-methyladenine (3MA) (Sigma), or 15 µM Ly294002 as pan-PI3K inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-isobutyl-1-methylxanthine (IBMX; Sigma), human epidermal growth factor (hEGF ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 nM 3-MC (213942, Sigma) or DMSO (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1-bromo-3-chloropropane (Sigma) using phase separation method.
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit phosphohistone-3 (Millipore, 1:500), rabbit anti-active caspase (R&D ...
-
bioRxiv - Neuroscience 2023Quote: ... β3 tubulin (1:1000, Sigma #T8578), peripherin (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... Colonies were fixed with Carnoy’s solution (1 acetic acid: 3 methanol) and stained with 1% (w/v) crystal violet (Sigma-Aldrich). The percentage of colonies covering the plates were calculated with ImageJ software.
-
bioRxiv - Neuroscience 2020Quote: ... FBS supplementation was decreased to 3% FBS 3 days prior to the addition of 10□M Retinoic Acid (RA; Sigma-Aldrich, R2625). During differentiation ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hrs followed by addition of 3 µM Asunaprevir (Apexio: BMS-650032) and 500 µM 3-Indoleacetic acid (Sigma Aldrich: I2886). Cells were treated with following inhibitors to inhibit indicated kinases ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 1.944 and 3.888 g, Sigma) were added to the mixture under stirring to activate 10 and 20 % of the carboxylic acid groups of the alginate ...
-
bioRxiv - Plant Biology 2021Quote: ... 250 μM or 1 mM L-glutamic acid monosodium salt monohydrate (Sigma Aldrich, cat No. 6106-04-3). Plants were analyzed in single blinded-experiments ...
-
bioRxiv - Cell Biology 2021Quote: To measure symplasmic connectivity using the HPTS (8-Hydroxypyrene-1, 3, 6-trisulfonic acid trisodium salt, SIGMA-ALDRICH) dye movement assay ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711) (Sigma-Aldrich).
-
bioRxiv - Biophysics 2023Quote: ... Samples were prepared in fully deuterated 400 mM SPB for all measurements and contained ∼1 mM 3-(Trimethylsilyl)propionic-2,2,3,3-d4 acid (Sigma-Aldrich) as a frequency reference.
-
bioRxiv - Developmental Biology 2023Quote: ... the L1 larvae were transferred to NGM+auxin plates with 1 mM 3-indoleacetic acid (IAA; Sigma #I2886) and kept in the dark ...