Labshake search
Citations for Millipore Sigma :
2351 - 2400 of 3147 citations for 6 ISOPROPYLINDOLE 97 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the tissue and cells were incubated in 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI, D-6564, Sigma, 1:1000). Biotinylated-secondary antibodies were from Vector Labs ...
-
bioRxiv - Immunology 2022Quote: ... For cell sorting cell suspensions were stained for viability with 1:3000 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) immediately before sorting.
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...
-
bioRxiv - Neuroscience 2022Quote: Demyelinating lesions were induced in the spinal cord of 10-week-old female C57BL/6 mice by a stereotaxic injection of 0.5 μl of 1% LPC (Sigma-Aldrich) in sterile 0.9% NaCl solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were washed in PBS and then incubated for 10 minutes in 1:10000 4’,6-diamidino-2-fenilindol (DAPI; Sigma) for nuclei counterstaining ...
-
bioRxiv - Microbiology 2022Quote: ... Excision of the GFP cassette in blood stage parasites was monitored by flow cytometry using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore) to detect GFP and mCherry ...
-
bioRxiv - Microbiology 2022Quote: MDCK-SIAT1 cells were infected with the PR8 NP:WT/F346S viruses at an MOI of 5 TCID50/cell in a 6 well plate in the presence of 100µg/mL of cycloheximide (Sigma-Aldrich). Infected cells were harvested at 2 and 6hrs post-infection ...
-
bioRxiv - Genomics 2022Quote: ... Cross-links were reversed by incubating the eluted samples and inputs at 42°C for 2 hours and 67°C for 6 hours in the presence of Pronase (Sigma) and TE buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were cleared by centrifugation at 17,000 g 12 min and input aliquot was incubated with 6 mM MgCl2 and Benzonase (1:75, EMD Millipore). The remaining lysate was diluted with 300 μl of dilution buffer + supplements and incubated with 25 μl of GFP- or Myc-Trap magnetic agarose beads for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... were separated on 0.1% SDS polyacrylamide gels (6–12% w/v depending on the molecular mass of protein) and electroblotted onto Immobilon-PVDF Transfer Membrane (Merck Millipore). Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin ...
-
bioRxiv - Microbiology 2020Quote: 2 μg mRNA suspended in 6 μl RNAse-free H2O was digested with 2 units of nuclease P1 (Sigma N8630) for 3 h at 37 ºC ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cortical neurons were plated in 6-well plates on coverslips coated with 100μg ml-1 poly-D-lysine (Sigma- Aldrich) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Plant Biology 2021Quote: ... and the detection of the total MAPK3 and 6 protein levels were by using polyclonal anti-MAPK3 (1:1000, Sigma) and anti-MAPK6 (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... the samples were mounted in polyvinyl alcohol-based mounting medium containing 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; FUJIFILM-Wako) and 2.5% (w/v) 1,4-diazabicyclo[2.2.2]octane (Sigma, St. Louis, MO, USA) as an antifade ...
-
bioRxiv - Neuroscience 2021Quote: ... one day after the apomorphine-induced rotation test the rats were administered daily 6 mg/kg L-DOPA (Sigma Aldrich) and 15 mg/kg benserazide HCl (purchased from the Chinese domestic market) ...
-
bioRxiv - Neuroscience 2020Quote: ... After rinsing sections were incubated 10 min at room temperature (RT) with 0.001 % DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, Sigma, D9542) in PBS for nuclear staining ...
-
bioRxiv - Biochemistry 2021Quote: ... from Arthrobacter ureafaciens (cat # 10269611001) and α2-6-sialyltransferase from Photobacterium damsela (Pd2-6ST, cat # S2076) were purchased from Sigma. CMP-Neu5Ac (cat # 233264 ...
-
bioRxiv - Neuroscience 2022Quote: ... HeLa cells were rinsed with PBS and cultured in the normal culture medium supplemented with 100 μM 6-aminonicotinamide (Sigma) (6AN ...
-
bioRxiv - Neuroscience 2022Quote: ... and four old (24-month old) male C57BL/6 mice were deeply anesthetized and perfused with cold PBS (Sigma, D8537). Each brain was carefully removed and individually micro-dissected under a dissection microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 μL of beads were washed with PBS and incubated with 6 μg of anti-FLAG antibody (Sigma-Aldrich, F1804) in PBS + 0.5% BSA at 4°C for 3 h with gentle rocking ...
-
bioRxiv - Genetics 2022Quote: ... Slides were then rinsed in washing buffer five times for 3 min each and nuclei were stained with 4lr,6-diamidino-2-phenylindole (DAPI, cat # D-1388, Sigma) at a concentration of 1 μg/ml for 10 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... cells were replated in 6-well plates with RPMI medium containing 1mg/mL G-418 (Sigma-Aldrich, St. Louis, MO). As we described previously (52) ...
-
bioRxiv - Physiology 2022Quote: ... virgin female flies were collected within 6 h of eclosion and reared on standard medium supplemented with 1.5 mM methoprene (Sigma-Aldrich, St Louis ...
-
bioRxiv - Immunology 2022Quote: ... The sections were washed in PBS and incubated 10 min with 4’,6-diamidino-2-phenylindole (DAPI, 1/10,000, Sigma-Aldrich) to visualize the cell nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were moved to a humidified chamber with primary antibody (anti-acetyl-alpha tubulin, clone 6-11B-1, Sigma, MABT868) diluted in PBX (1:250 ...
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Immunology 2019Quote: ... Fluorescein isothiocyanate (FITC) [2-(6-hydroxy-3-oxo-3h-xanthen-9-yl)-5-isothiocyanatobenzoic acid] was purchased from Sigma-Aldrich Korea ...
-
bioRxiv - Neuroscience 2019Quote: ... 5, 6 and 7 (days 52 to 55 in the overall timeline, Figure 2) at 100 mg/kg ip (Sigma), at approximately 17:00 hr ...
-
bioRxiv - Bioengineering 2019Quote: Substrates were placed into 6-well plates and both chambers were washed three times with 50 mM HEPES pH 8.5 (Sigma H3375). The polyacrylamide was activated for ECM protein coating by covering the substrates with 500 μL of 0.5 mg/mL sulfo-SANPAH (Proteochem c1111 ...
-
bioRxiv - Biochemistry 2019Quote: ... or doxycycline-treated (Dox) (1 µg/ml for 6 days) AW13516-shNPM1-luc+ cells using the GenElute Mammalian Total RNA Miniprep Kit (Sigma) followed by On-Column DNase I Digestion as per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... ten first or second leaves from independent plants were harvested at the indicated time points and transferred to a 15 ml tube containing 6 ml water purified using a Milli-Q integral 5 water purification system (Millipore). After a 6 h-incubation at room temperature on a horizontal shaker ...
-
bioRxiv - Neuroscience 2019Quote: ... Picked spheres were plated (20 spheres per well of a 6-well plate) onto Nunclon-Δ plates coated with 0.1 mg mL−1 poly-L-ornithine (Sigma) followed by 10 µg mL−1 laminin (PO/Lam coating ...
-
bioRxiv - Cancer Biology 2019Quote: ... 25 μl Ad5CMVFlpO (6 × 1010 PFU/ml) was incubated with 600 μl minimum essential media (Sigma-Aldrich, St Louis, MO) and 3 μl 2 M CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 6 µl homogenate was mixed with 94 µl Glucose Oxidase (GO) reagent from the Glucose (GO) Assay Kit (Sigma, GAGO20) containing 1 µl (0.3 U ...
-
bioRxiv - Cell Biology 2019Quote: ... The sample was then cut in half with a clean razor and each piece was placed in a 6-well plate with 10 ml of ASW and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma) at a final concentration of μg/ml (or an equal volume of sterile diH2O ...
-
bioRxiv - Molecular Biology 2019Quote: ... U2OS cells were seeded in a 6-well plate and infected with lentivirus supernatant in the presence of 5 μg/mL polybrene (Sigma). Medium was replaced by fresh media with 10 μg/mL Blasticidin S at 24 hours post-infection ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Molecular Biology 2019Quote: ... All RNAs were then selectively modified with 10mM 1-methyl-6-nitroisatoic anhydride (1M6) (Sigma-Aldrich cat no. S888079-250MG) for 5 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sections were further incubated for 10 min at room temperature with DAPI (4’,6-diamidino-2-phenylindole, 1:5000, Sigma). Incubation with the secondary antibodies lasted for 3h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and resuspended in 50 to 80 µl FC buffer containing 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Primary tumor samples were stained with CD45-APC-Cy7 (Biolegend ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dechorionated live embryos were incubated for 6, 12 and 24 hours in 40μM Nifedipine or 20mM BDM (2, 3-butanedione-2-monoxime) (Sigma-Aldrich) in Danieau’s solution ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... To identify the total number of cells the nuclei were stained with DAPI (4’, 6-Diamino-2-phenylindole dihydrochloride) (1:10000, Millipore-Sigma). Images were acquired using Olympus BX61 microscope and analyzed using Fiji software (ImageJ).
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...