Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... viral transduction was performed by spin-infection with 2,000 g at 33 °C for 2 hours in the presence of 16 µg/ml polybrene (Sigma-Aldrich, Cat# H9268), followed by incubation for another 4 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chromatin from about 1.5×106 cells was incubated overnight at 4°C with 2–5 μg antibodies to FLAG epitope (M2; Sigma-Aldrich, #F1804, RRID:AB_262044), BRD4 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2023Quote: The CaCl2 working solution was prepared by mixing 484.5 µL medium (see cell culture section) and 15.5 µL 2 M CaCl2 (Sigma Aldrich, cat# C-7902). This was followed by the preparation of the Annexin V solution consisting of 3 mL cell culture medium ...
-
bioRxiv - Microbiology 2024Quote: ... was grown (~25°C) in TB medium with 2% DMSO with or without 150 mg/L acyclic naphthenic acids (Sigma Aldrich 70340,15), or 150 mg/L of custom mix of 9X naphthenic acids (Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The remainder of transformed cells were incubated shaking at 300 rpm for 30 minutes at 37 °C before they were added to 2 mL of LB with a final concentration of 50 ug/mL Ampicillin (Sigma-Aldrich, A5354) and incubated shaking at 300 rpm overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... in 1X PBS for 7 min and then 100 mM glycine (Sigma) in 1X PBS for 10 min ...
-
bioRxiv - Biophysics 2021Quote: ... The buffer was replaced with 50 mM HEPES (pH 7; Sigma-Aldrich) for alkaline phosphatase and hexokinase and 50 mM MES (pH 6 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 13 mg ethyl decanoate and 7 mg ethyl dodecanoate (all Sigma Aldrich). Subsequently ...
-
bioRxiv - Bioengineering 2022Quote: ... PEG was conjugated to nanoparticles using 7 mM N-Hydroxysulfosuccinimide (NHS) (Sigma) and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl ...
-
bioRxiv - Plant Biology 2019Quote: 7-Diethylamino-4-methylcoumarin (Sigma D87759-5G, 50 mg/ml in DMSO)
-
bioRxiv - Biophysics 2019Quote: ... 22 µg/mL adenosine (Sigma Aldrich, cat# A9251, CAS: 56-61-7), 1 µg/mL calcium pantothenate (TCI ...
-
bioRxiv - Genetics 2019Quote: ... and 10mg/mL calcofluor white stocks (Sigma-Aldrich CAS#4404-43-7) were also made from powder and diluted into ddH20 ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from 7-day old seedlings using Trizol (Sigma). The extracted RNA was treated with DNase (Fermentus ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The standard (7 standard points) was prepared from MDA (Sigma Chemicals, USA). The samples were analyzed in black 384-well plates and fluorescence intensity was measured at an excitation/emission wavelength of 530/550 nm.
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... containing 7 % fetal calf serum (FCS) (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... slides were gradually dehydrated and mounted in Eukitt (Sigma 25608–33-7). Nissl staining was performed on some sections following conventional histological procedures ...
-
bioRxiv - Plant Biology 2021Quote: ... 70 mL ½ MS media (including vitamins without sucrose, pH 7, Sigma-Aldrich GmbH ...
-
bioRxiv - Microbiology 2019Quote: ... D508N) [7] substitution were grown in Dulbecco’s modified Eagle’s medium (DMEM, Sigma) supplemented with 10% fetal calf serum (FCS).
-
bioRxiv - Synthetic Biology 2022Quote: ... and incubated with 7 mL of 6 ppm CdCl2 (Sigma Aldrich 202908) in ddH2O for 90 min on an orbital shaker ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-HA (mouse monoclonal Clone HA-7, 10 µg/mL, Sigma Aldrich) or anti-Pf ERC (rabbit serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... supple-mented with 7% charcoal treated Fetal Bovine Serum (FBS) (Sigma, F7524), 1% Penicillin-Streptomycin (P/S ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Reagent B: Sodium thiosulfate pentahydrate (Na2S2O3 : 5H2O, Sigma, CAS# 10102-17-7) was typically dissolved in DPBS at 0.2 M.
-
bioRxiv - Neuroscience 2021Quote: ... Clozapine-n-oxide (Sigma, 34233-69-7, CNO, 1 mg/kg, I.P.) and saline (1 mg/kg ...
-
bioRxiv - Immunology 2019Quote: The cells were cultured for 6-7 days in IMDM (Sigma-Aldrich) with 20 % heat-inactivated fetal calf serum (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2019Quote: ... 225 μL of NiCl2 (250 mM) and 7 mg of DAB (Sigma)) ...
-
bioRxiv - Biochemistry 2019Quote: Analytical standards of D-glucose from Sigma Aldrich (Cas# 50-99-7), Glucose-3-phosphate synthesized by Chiroblock ...
-
bioRxiv - Molecular Biology 2019Quote: ... medium for MCF-7 cells contained 1 mM Sodium-Pyruvate (Sigma-Aldrich). MCF-10A cells were cultured in DMEM/F12 medium (Pan-Biotech ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-HA HA-7 agarose beads (Sigma-Aldrich, St. Louis, MO) overnight at 4°C with end-over-end mixing ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7) using an Amicon 0.5 mL 3k MWCO centrifugal filter (Millipore). Sample concentrations ranged from ~250 μM to ~1.4 mM at 500 μL volume ...
-
bioRxiv - Microbiology 2021Quote: ... with 7·5/1·875 mg/kg levodopa/carbidopa (D9628/C1335, Sigma), 0·15 mg/kg ropinirole (R2530 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Row 7 contained erythrocytes suspensions with 0.1 % Triton-X100 (Sigma-Aldrich UK) as a positive control and row 8 contained only erythrocytes as the negative control ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-7 dpf larvae were anaesthetized in 0.01% chilled tricaine (Sigma-Aldrich) and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar ...
-
bioRxiv - Microbiology 2019Quote: ... Huh-7 and Vero cells were grown in DMEM medium (Sigma, USA) at 37 °C and 8% CO2 atmosphere ...
-
bioRxiv - Immunology 2020Quote: ... MCF-7 was cultured in EMEM (Sigma-Aldrich, St; Louis, MO, USA), while A-375 cells were cultured in DMEM (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... powder was dissolved in corn oil (Sigma-Aldrich, CAS: 8001-30-7) to a final concentration of 40 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were incubated with anti-HA-agarose beads (Sigma; clone HA-7) for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 mg/ml α-cyano-4-hydroxycinnamic acid (CHCA; Sigma, MO, USA) added to 50% acetonitrile was applied with an HTX M5 sprayer.
-
bioRxiv - Pathology 2023Quote: ... Frozen sections (7 μm) were permeabilized in 0.25% saponin (47036, Sigma-Aldrich) for 30 min and then blocked for 30 min in PBS containing 0.1% saponin ...
-
bioRxiv - Bioengineering 2023Quote: ... PEG was conjugated to nanoparticles using 7 mM N-Hydroxysulfosuccinimide (NHS) (Sigma) and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: TBBPA (97% purity) (CAS #: 79-94-7) was purchased from Sigma-Aldrich. N-[4-chloro-3-(trifluoromethyl)phenyl]-2-ethoxy-6-pentadecyl-benzamide (CTPB ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...