Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... parasites were cultured for ∼7 days in 1 µM doxycycline (Sigma, D9891) and 200 µM isopentenyl pyrophosphate (Isoprenoids ...
-
bioRxiv - Systems Biology 2024Quote: ... 7-ethyl-10-hydroxycamtothecin (SN-38; Sigma-Aldrich, St. Louis, MO; H0165), or 3-bromopyruvate (3-BP ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 7% FCS tested to be dox-free (Sigma-Aldrich, Germany), and penicillin (100 U/mL ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC; Sigma-Aldrich) were added drop-wise at 5000 molar equivalents to the alginate solution while stirring ...
-
bioRxiv - Neuroscience 2024Quote: ... a 3 mm-thick agar gel cap (Sigma, 3% in distilled water) was placed between the head and the surface coil ...
-
bioRxiv - Neuroscience 2024Quote: ... The two odors used were 3-octanol (3-Oct) (Sigma-Aldrich 218405) and 4-methyl-cyclohexanol (MCH ...
-
bioRxiv - Immunology 2020Quote: ... After dialysis external solutions were mixed and were concentrated by Centricon YM-3 (from Merck-Millipore, used at 5000 x g for 30 minutes, 4 °C) to reach 1 ml as final volume ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: Nutlin-3 (Sigma, N6287) was dissolved in corn oil (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... 3% donkey serum (Millipore), and 0.2% Triton X-100 in PBS ...
-
bioRxiv - Genetics 2019Quote: ... 3 mM ATP (Sigma), 1 mM CaCl2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pHistone 3 S10 (Millipore), pp53 S15 (Cell Signaling) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3% BSA (Sigma) in PBS for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μM SB202190 (Sigma), 1 μM nicotinamide (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 µL fibronectin (Sigma) and 50 µL cell type-specific medium (RPMI1640 – mouse ...
-
bioRxiv - Immunology 2021Quote: ... and 3% sucrose (Sigma) for 13 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... 3′-Diaminobenzidine (Sigma-Aldrich) as a substrate ...
-
bioRxiv - Microbiology 2020Quote: ... 3-HPPA (91779, Sigma) (n=4 biological replicates ...
-
bioRxiv - Systems Biology 2020Quote: ... 3% Dextran (Millipore Sigma)) containing various amount of NaCl so that the final concentration of NaCl would correspond to those in Fig ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...
-
bioRxiv - Biophysics 2020Quote: ... 3 uL benzonase (Novagen)) and sonicated ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 (Sigma P0044). Protein concentration was determined using the Bradford assay (BioRad ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (Sigma P0044)) was added directly to the mortar and samples were homogenized in buffer for 2 min ...
-
bioRxiv - Genetics 2022Quote: ... or 3% BSA (Sigma) in TBS with 0.1% Tween20 ...
-
bioRxiv - Microbiology 2021Quote: ... CHIR99021 (3 µM; Sigma), RSPO1 (R-spondin 1 ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... HSV (69171-3; Novagen), and HA (3F10 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3% donkey serum (Millipore), and 0.3% Triton-X at 4°C for 2 h ...
-
bioRxiv - Systems Biology 2019Quote: ... 3 μM (Sigma CHIR99021), 1000 U/mL LIF (EMD Millipore ESG1107) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... or 3-octanol (Sigma) diluted 1:500 and 1:250 respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 µM SB431542 (Sigma), and 0.1 µM Compound E (Millipore ...
-
bioRxiv - Immunology 2019Quote: ... 3 M NaAc (Sigma) and 1 µl GeneElute (Sigma ...