Labshake search
Citations for Millipore Sigma :
1251 - 1300 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Microbiology 2020Quote: ... indole-3-actic acid (Sigma, 2 mM) were freshly prepared for serial dilutions (10x ...
-
bioRxiv - Neuroscience 2022Quote: ... phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates sat on ice for 30min with intermittent vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-methylene-2-norbornanone (Sigma; Cat# M46055), lumiflavin (Cayman Chemical ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma) and benzonase (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and phosphatase inhibitors 2 and 3 (Sigma). Lysates incubated on ice for at least 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... β2/3 subunit (Millipore, catalog #: 05-474) (1:250 dilution) ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM Ca(NO3)2 ×24H2O (13477-34-4, Sigma), 2.5 mM KH2PO4 (7778-77-0 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated with primary antibodies diluted in blocking buffer over night at 4°C (SHIP1, 1:500 dilution, Cell Signaling Technologies; IBA1, 1:500 dilution, abcam; GAPDH, 1:10,000 dilution, Millipore; PAFAH/PLA2G7 ...
-
bioRxiv - Microbiology 2020Quote: ... Fractions containing PelXC232S were pooled and concentrated to a volume of 2 mL by centrifugation at 2 200 × g at a temperature of 4 °C using an Amicon ultra centrifugal filter device (Millipore) with a 10 kDa molecular weight cut-off ...
-
bioRxiv - Cell Biology 2020Quote: ... Immunoprecipitations were performed on 2 mg of total protein by incubating 2h at 4°C with anti-Flag agarose beads (Sigma). Beads were then washed in lysis buffer and bound polypeptides analyzed by SDS-PAGE and immunoblotting ...
-
bioRxiv - Biophysics 2020Quote: ... The virus-containing supernatant was concentrated by ultracentrifugation in a SW-28 rotor (25,000 rpm, 2 h, 4°C) using OptiPrep density gradient medium (Sigma-Aldrich). Virus containing fractions were collected ...
-
bioRxiv - Cell Biology 2021Quote: ... Cdc5-3V5 and Rim4-3V5 (control non-kinase tagged protein) were immunoprecipitated at 4°C 2 hours using 20 µL of anti-V5-agarose slurry (Sigma). Purifications were washed 4 times with NP40 buffer.
-
bioRxiv - Biophysics 2021Quote: ... The virus-containing supernatant was concentrated by ultracentrifugation in a SW-28 rotor (25,000 rpm, 2 h, 4°C) using OptiPrep density gradient medium (Sigma-Aldrich). Part of the supernatant containing pelleted viruses was collected ...
-
bioRxiv - Biochemistry 2022Quote: ... membranes were equilibrated at 4 °C and incubated for 30 min in the presence of 2 mg/ml iodoacetamide (Sigma). Membranes were then solubilized in 10 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... supernatant was collected in clean microcentrifuge tube and incubated 2 h at 4°C with a-flag mouse antibody (Sigma), following 1 h incubation at 4°C with PureProteomeProtein A/G Magnetic Beads Mix (Millipore) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein lysate was immunoprecipitated for 2 hours at 4°C with the following antibodies: rabbit anti-myc (2.5 μg, Millipore Sigma), mouse anti-HA (2.5 μg ...
-
bioRxiv - Plant Biology 2020Quote: ... stratified for 2 d at 4°C in the dark and sown on Gamborg’s B5 Basal Salt medium (Sigma G5768) supplemented with 1% (w/v ...
-
bioRxiv - Genetics 2020Quote: ... and precipitated with antibodies overnight at 4°C followed by incubation for 2 h with protein G Sepharose beads (Millipore). Normal mouse or rabbit IgG (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... at 25,000 x g for 2 h at 4°C on a 20% sucrose cushion (Sigma-Aldrich, St. Louis, MO). Media and sucrose were discarded ...
-
bioRxiv - Biochemistry 2021Quote: ... The second half of the clarified lysate was incubated for 2 h at 4°C with 20 μl of Anti-FLAG M2 magnetic beads (Sigma) equilibrated in FLAG wash buffer containing 20 mM HEPES pH 8.0 ...
-
bioRxiv - Pathology 2021Quote: ... at 25,000 x g for 2 hours at 4 °C on a 20% sucrose cushion (Sigma-Aldrich, St. Louis, MO). Media and sucrose were decanted ...
-
bioRxiv - Neuroscience 2021Quote: ... Following electrophoresis, proteins were transferred (100 V, 2 hr, 4°C) to polyvinylidene difluoride membranes (Immobilon-FL, Millipore, Billerica, MA). To confirm protein transfer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each sample was incubated with primary antibodies for 1–2 h at room temperature or overnight at 4°C and then with fluorescent-conjugated secondary antibodies and DAPI (Sigma) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... 500 μg of total protein from PC12 cell extracts were incubated over night at 4°C with 2 μg of the phospho- tyrosine 4G10 (Sigma-Alrich/Upstate Cat# 05-321 ...
-
bioRxiv - Molecular Biology 2022Quote: 400 μl of cell lysate was incubated overnight at 4 °C with 2 μg of anti-Myc or anti-Flag antibody (Sigma). Protein A-Sepharose (GE ...
-
bioRxiv - Neuroscience 2024Quote: ... Media was incubated at 4 °C for 2 hours in 20% PEG solution (40% w/v stock: 2.5 M NaCl, 40% PEG (Sigma P2139) followed by a 20 min 3,000 x g spin at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... slides were washed for 5 min in 0.1x SSC with 1% Triton X-100 at 62°C and counterstained with 0.5 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich) in antifade with DABCO (1,4-diazabicyclo (2.2.2)-octane ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was concentrated using ultracentrifugation in an SW-28 rotor (25,000 rpm, 2 h at 4°C) on a 60% OptiPrep density cushion (Sigma-Aldrich). The pelleted viruses were resuspended in 10 mL TNE buffer (50 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: ... cells were centrifuged with 293T retroviral supernatant at 1000×g for 2 hr at 37°C in the presence of 4 µg/mL polybrene (Sigma). Following spin infection ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysate was clarified by centrifugation and incubated for 2 hours at 4 °C with anti-FLAG M2 agarose beads (Sigma) with gentle rotation ...
-
bioRxiv - Cell Biology 2024Quote: ... The lysates were centrifuged at 15,000 × g for 15 min at 4 °C and were incubated for overnight at 4 °C with anti-FLAG M2 antibody (F1804, Sigma-Aldrich). Subsequently ...
-
bioRxiv - Cell Biology 2019Quote: 5-7 day old adult females were fed on 0,5% Methylene Blue (Sigma) dissolved in 85% heat-killed yeast paste for 5 hours at 25°C secondary to 5 hours starvation ...
-
bioRxiv - Neuroscience 2019Quote: ... supernatant discarded and spheres digested for 5-7 min in Accumax solution (Sigma). With the help of a pipette ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5-7 minutes and neutralized with trypsin neutralization solution (Sigma, Cat. #T9253). Neurons were then counted and plated onto Laminin-treated coverslips (Neuvitro ...
-
bioRxiv - Neuroscience 2019Quote: ... and spinal cords of both sexes (n = 3 each) were fixed in 4% PFA and embedded in 5% agarose (Type IX-A; Sigma-Aldrich) supplemented with 20% sucrose ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fertilized oocytes were collected from 3-4 week-old superovulated C57Bl6 females prepared by injecting 5 IU each of pregnant mare serum gonadotrophin (PMSG) (Sigma Aldrich) and human chorionic gonadotropin (hCG ...