Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Biophysics 2020Quote: ... 7 µg ml-1 gentamycin (#G1372, Sigma), 10 µg ml-1 tetracycline (#T3258 ...
-
bioRxiv - Neuroscience 2020Quote: ... pilocarpine (P6503, Sigma-Aldrich, 7 mL.kg−1), cocaine HCl (Cooper France ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse αHA (1:500, HA-7 Sigma), rabbit αPTP7 (1:500) ...
-
bioRxiv - Cell Biology 2022Quote: ... 7-AAD (1μg·mL-1, Millipore Sigma, #A9400) or DAPI (0.5μg·mL-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 7-AAD (1μg·mL-1, Millipore Sigma, #A9400) or DAPI (0.5μg·mL-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase-7 (1:1000, Sigma-Aldrich, #SAB4503316), LC3 (1:5000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1:500 Cytokeratin-7 (Millipore Sigma MABT1490), and 1:200 E-cadherin (BD Biosciences 610181) ...
-
bioRxiv - Genetics 2024Quote: ... 1:5000 (H3663 HA-7, Sigma-Aldrich), Rabbit anti-Casp ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-7 dpf larvae were anaesthetized in 0.01% chilled tricaine (Sigma-Aldrich) and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar ...
-
bioRxiv - Neuroscience 2021Quote: ... one PBS wash for 5’ and embedded in Fluorsave (Millipore, 2848323).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 5% skim milk for 1 hour and incubated at 4 °C overnight with antibodies including α-c-Myc produced in rabbit (Sigma-Aldrich, C3956, 1:2,000), and α-HA high affinity produced in rat (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... then 10min at 4°C in the Lysis buffer 2 (50mM Tris pH8, 10mM EDTA, 0.5% NP-40, Complete protease inhibitor (Sigma)) and subsequently sonicated in 15ml conical tubes with a Bioruptor Pico (Diagenode ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell lysates were cleared by centrifugation and incubated at 4°C for 1.5–2 h with anti-FLAG M2 affinity gel (Sigma). After extensive washing with native IP buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primary acinar cells were pelleted (80 g, 2 min, at 4 °C) and re-suspended in Waymouth media (Sigma). To obtain acinar-cell-conditioned media ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were cleared by centrifugation at 16,000 xg at 4°C for 2 min and Pah1-FLAG was immunoprecipitated with anti-FLAG agarose beads (Sigma) at 4°C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were incubated for 2 h on a rotating wheel at 4°C with anti-FLAG M2 beads (Sigma). Beads were washed once with lysis buffer (without benzonase ...
-
bioRxiv - Immunology 2023Quote: ... Serum and supernatant from homogenized tissues were incubated overnight at 4°C with 2% Trichloroacetic acid solution (Sigma, #T0699) at a 1:1 dilution ...
-
bioRxiv - Biochemistry 2023Quote: ... and the supernatant was incubated for 2 h at 4 °C with 150 μL streptavidin-agarose beads (Sigma-Aldrich) under gentle agitation ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-α-tubulin antibodies (clone B-5-1-2, Sigma-Aldrich) at 1:5000 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Tubulin (T5168, Clone B-5-1-2) was from Sigma Aldrich.
-
bioRxiv - Biochemistry 2021Quote: A monoclonal anti-α-tubulin (SIGMA, T5168, Clone B-5-1-2) was used in western blots as a loading control ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mg·ml-1 iodoacetamide and 5 U/l Salt Active Nuclease (Sigma) for 1 h at 4 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Biochemistry 2020Quote: ... The recovery of RNase A activity was measured by monitoring the linear increase in absorbance at 295 nm on a U-3900 spectrophotometer (HITACHI) at 30°C after addition of 1.25 mM cytidine 2′,3′-cyclic monophosphate monosodium salt (cCMP, Sigma-Aldrich) to reaction mixtures at indicated time points.
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Immunology 2021Quote: ... that contain two parallel channels separated by a porous membrane (7 μm pores) were first perfused and incubated with 1% 3-Aminopropyltrimethoxysilane (Sigma, 281778) in ethanol for 1 hour and then incubated in an 80°C oven overnight ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-α-tubulin (1:2,000; clone B-5-1-2, Sigma-Aldrich, cat. # T5168) and mouse anti-MIC2 (1:2500 ...
-
bioRxiv - Neuroscience 2022Quote: Larvae (24 hpf to 7 dpf) were fixed in 4% paraformaldyehyde (PFA; Sigma) for one hour shaking at room temperature (RT ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 µM phytic acid dipotassium salt (Sigma, 5681, CAS: 129832-03-7) for the indicated time.
-
bioRxiv - Molecular Biology 2021Quote: ... X0-3 and X0-4 oligonucleotides (Sigma-Aldrich) in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µM 4-hydroxytamoxifen (OH-Tam, Sigma Aldrich) was added to induce Cre-mediated recombination in the mouse Ctsd gene resulting in a premature stop codon ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 and 4 were custom made from Sigma in the pLKO.1-Puro-CMV-tGFP vector backbone ...