Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 4 ng/mL human NT-3 (Sigma-Aldrich), and 1 μg/mL laminin (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4-methylcyclohexanol (CAS #589-91-3, Millipore Sigma), pentyl acetate (CAS #628-63-7 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM glyceraldehyde-3-phosphate (G3P; Sigma-Aldrich), 4 mM nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Bioengineering 2020Quote: ... 2-hydroxy-4’-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959, 410896, Sigma Aldrich), VEGF specific control aptamer (47-nt ...
-
bioRxiv - Neuroscience 2021Quote: ... One hemisphere was post-fixed overnight with 4% paraformaldehyde (Sigma-Aldrich, #28908) in PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Microbiology 2019Quote: ... J774 murine macrophage-like cells were cultured for a minimum of 4 passages in T75 tissue culture flasks at 37°C 5% CO2 in DMEM (High glucose, Sigma) supplemented with 10% Fetal Bovine Calf Serum (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mg of proteins was used to performed incubation overnight at 4°C with 5 μg of anti-Flag mouse antibody (Sigma) in 250 μL of complemented non-denaturing lysis buffer ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then centrifugated at 500g for 5 minutes at 4°C and then were resuspended in 1mL Nuclei PURE Storage Buffer (Nuclei PURE storage buffer, Sigma). Sample washing was performed until the supernatant cleared ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sonicated lysates were pelleted for 5 min at 14000 rpm in a microcentrifuge and the entire supernatant was transferred to a new microfuge tube and incubated overnight at 4°C with 5 µg of anti-Myc antibody (9E10) and 20 µl of protein G magnetic beads (Millipore). Following IP ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were incubated O/N at 4°C followed by two washing steps of 5 minutes with Wash Buffer A (Sigma) at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The fluid was centrifuged at 500xg for 5 min at 4°C and resuspended in RBC lysis buffer (Sigma, R7757) for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... the cells were firstly cultured for 4 h in a 37°C/5% CO2 incubator with 50 ng/ml PMA (Sigma) and 1 mM ionomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei and other debris were pelleted at 2,000 g for 5 min at 4°C and the supernatant was filtered through three layers of 100 μm pore nylon mesh (Millipore), and a 5 μm pore PVDF syringe filter (Millipore) ...
-
bioRxiv - Genomics 2024Quote: ... Embryos were then incubated overnight at 37°C under 5% CO2 in humidified air in 4-well culture dishes containing KSOM media (Millipore). Experiments were approved by the SIMR IACUC and were performed following the committees’ guiding principles.
-
bioRxiv - Neuroscience 2024Quote: ... and blocked with 5% milk in TBS-Tween 20 for 2h and incubated with primary antibodies diluted in the 5% BSA in TBS-Tween 20 overnight at 4°C (AMPD2, Sigma HPA045760 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were reconstituted in 100 µL and 2 µL of the sample was injected from a 4 °C autosampler into a ZIC-pHILIC 150 × 2.1 mm 5 µm particle size column (EMD Millipore) with a ZIC-pHILIC 20 x 2.1 guard column in a Vanquish Duo UHPLC System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... RT complete IntestiCult containing 25μg/ml was added, and enteroids were incubated (37°C, 5% CO2) until fixation with 4% paraformaldehyde (PFA; Sigma Aldrich) at 4h p.i ...
-
bioRxiv - Microbiology 2023Quote: ... and remaining lysate was end-over-end incubated with 5 µg of primary Ab overnight at 4°C [Rabbit-anti-HA (Sigma), Rabbit-anti-Flag (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... The conditioned media was spun down for 5 minutes at 800g and 4°C and then filtered with a syringe and 0.22 μm filter (Millipore, SLGV033RS) and stored at 4°C for no more than three days before being applied to cells ...
-
bioRxiv - Molecular Biology 2023Quote: The sorted cells were concentrated by centrifugation at 300 x g for 5 minutes at 4 °C and resuspended in DPBS (Sigma) with 0.04% w/v BSA (Sigma) ...
-
bioRxiv - Systems Biology 2023Quote: ... All membranes were blocked in a 5% milk solution and then incubated for 12h at 4°C with either the mouse anti-phosphotyrosine 4G10 (05321, Millipore) or the rabbit anti-GFP (Thermo A11122 ...
-
bioRxiv - Microbiology 2023Quote: ... The insoluble matter was removed by centrifugation 10000×g for 5 min at 4 °C and protein was estimated using BCA kit (Sigma) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... The solubilized nucleoproteins were cleared by centrifugation at 20,400xg for 5 min at 4°C followed by filtration using an Ultrafree-MC spin column (Millipore, UFC30GV0S).
-
bioRxiv - Cell Biology 2023Quote: ... The lysate was clarified by centrifugation at 20,000 × g for 5 min at 4°C and filtered on an Ultrafree-MC GV Centrifugal filter (Millipore, UFC30GV0S). Superose 6 Increase HR 10/300 column (Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C), resuspended in 5 ml lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 0.5ξ CellLytic B (Sigma-Aldrich), 1 % Triton X 100 ...
-
bioRxiv - Immunology 2024Quote: ... at 37°C in pre-warmed epithelial cell removal solution (HBSS supplemented with 4% iHS [Sigma] and 5 mM EDTA [Sigma]). The remaining tissues containing lamina propria and muscularis layer were digested for 20 min digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were extracted and post-fixed for at least 1 day in 4% PFA at 4°C and transferred to 30% sucrose (Millipore Sigma) for at least 1 day at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) for 1 hour at room temperature and then incubated at 4°C overnight with primary antibodies (anti-multicillin, Sigma Aldrich, HPA058073 1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... centrifuged (500g at 4°C for 4 minutes) and resuspended in PBS containing 1 μg/mL DAPI (Sigma Aldrich, D9542-100MG). Analysis of flow cytometric data was preformed using the BD Fortessa X20 and FlowJo v10 software (Ashland) ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were extracted and post-fixed for 1 day in 4% PFA at 4°C before transferring to 30% sucrose (Millipore Sigma) in PBS at 4°C ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... Lipids were extracted from the cell pellets through one-phase extraction with 202 uL of BuOH:MeOH (1:1) (Sigma 71-36-3 and 67-56-1) that contains 10 umol of cholesterol-d7 (Cayman Chemical 83199-47-7 ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 30 minutes at 4°C and stained with 50 μg ml-1 PI (Sigma). Samples and results were analyzed by FACS-Aria and FlowJo (FlowJo ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specimens were counterstained with DAPI overnight at 4°C (Sigma, 1 μg/ml in PBSTx).
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated overnight at 4°C with mEM48 (1:500, Merck Millipore, Cat. # MAB5374) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated overnight at 4°C in HRP-anti-DIG antibody (1/1500, Sigma) in TNB ...
-
bioRxiv - Pathology 2021Quote: ... tissues were stained overnight at 4°C with rat anti-laminin (1:1000, Sigma L0663) in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... following 1 h incubation at 4°C with PureProteomeProtein A/G Magnetic Beads Mix (Millipore). Beads were washed with GTEN buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were incubated with primary antibodies overnight at 4°C (anti-RBPMS (Millipore, 1:250), anti-GFP (AbCAM ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... followed by overnight incubation at 4°C in mouse anti-synaptophysin (1:200, Sigma Aldrich). Sections were then incubated at room temperature for 2 h in biotinylated goat anti-mouse (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight (4°C) with 1:1000 anti-Puromycin antibody (MABE343, Millipore) in 5% milk TBST with gentle rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... in PBS before overnight incubation at 4°C with antibodies anti-γH2AX (1:250) (Millipore), followed by 1 hour incubation at RT with antibodies anti-rabbit Alexa-Fluor 488 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... membranes were incubated overnight at 4 °C with anti-SDHB (1:1000; Sigma-Aldrich, #HPA002868), anti-DNMT1 (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and probed overnight at 4 °C with mouse anti-HA (1:5,000; Sigma-Aldrich, 12CA5), rabbit anti-PSTAIR (1:5,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated overnight at 4°C in biotinylated goat anti-rabbit secondary antibody (1:200; Sigma) in blocking solution ...