Labshake search
Citations for Millipore Sigma :
9801 - 9850 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... samples were washed with vDISCO washing solution for 3 hours and 3DISCO clearing60 with 50-70-90-100-100% tetrahydrofuran (THF) (Sigma, 186562), 1h each ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... Anhydrous 100% ethanol solution was prepared by adding 15 g of molecular sieve beads (Sigma 208582, 3 Å, 8-12 mesh) to 500 mL 100% molecular grade ethanol (Sigma E7023) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... diluted in corn oil (CO, used as vehicle) at 3 mg/kg for 4 days while CO mice received corn oil only (Sigma Aldrich). One cage of n=6 mice per group was used ...
-
bioRxiv - Physiology 2023Quote: ... and then incubated overnight at 4°C in primary antibodies diluted in 50% blocking buffer / 50% Tris buffered saline (bioWORLD #42020056–3) + 0.1% TWEEN (Sigma-Aldrich #P9416) (TBS-T) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.74 mmol of 3 or 4 azidoacids were stirred for 10 minutes at 40°C in minimal dimethylformamide (Sigma-Aldrich, 319937). The solution was then added with 0.74 mmol of DCC (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: Regeneration of the chip surface was achieved by brief exposure (30 s) to a solution containing 3 M solution of KSCN (Sigma-Aldrich). BIAevaluation software (version 4.1.1 ...
-
bioRxiv - Microbiology 2023Quote: ... culturing in liquid media used 10 mL of a mixture of a 2:3 ratio of Todd-Hewitt broth (Sigma-Aldrich) with 0.5% yeast extract (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 mM glucose final concentration; 10 g tryptone [Fisher Bioreagents, BP1421], 5 g yeast extract [Fisher Bioreagents, BP1422], 3 g K2HPO4 [Sigma-Aldrich, P3786] ...
-
bioRxiv - Immunology 2023Quote: ... mice were orally gavaged with 150 μL of an 80 mg/mL solution of 3-5 kDa-FITC-Dextran (Sigma-Aldrich) in PBS ...
-
bioRxiv - Biophysics 2023Quote: ... Glass coverslips were plasma activated and incubated with a solution of 2% (v/v) 3-(trimethoxysilyl)propyl methacrylate (440159-500ML, Sigma Aldrich) and 1% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were treated for 2 h at room temperature with 3% bovine serum albumin (BSA, Sigma-Aldrich, St. Louis, MO, USA), and 0.3% PBS-T as a blocking agent ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... autologous plasma samples were taken from the top layer and the “buffy coat” was extracted and washed 3 times with 1x PBS (Sigma-Aldrich) at 300 x g ...
-
bioRxiv - Genetics 2023Quote: BCL11A enhancer DHS +58 and +55 core regions were amplified with KOD Hot Start DNA Polymerase (EMD-Millipore, cat# 71086-3) and corresponding +58 Sanger primers ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were rinsed three times with PBS and blocked for 1 hour at RT in blocking buffer made with 3% BSA (Merck Millipore, 0218072801) and 0.02% Triton X-100 (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... solution for 3 hours at 4°C under gentle agitation and then washed it three times in TBS/Tween20 (TBST) buffer (Sigma Aldrich). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sub culturing was done once in 3-4 days and involved pelleting and washing cells with PBS followed by incubation with accutase (Sigma-Aldrich) and repeated pipetting in NSM medium to dissociate the spheroids ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stained with freshly made Oil Red O solution (2 parts Milli-Q and 3 parts Oil Red O, Sigma Aldrich). Osteocytes were fixed with ice-cold 70% ethanol at 4°C and stained with freshly prepared supernatant of saturated Alizarin Red S (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: A 10 mg/mL suspension of TAG drops was prepared by dissolving 1 mg of 1,2-dioleoyl-3-palmitoyl-rac-glycerol (Sigma-Aldrich Inc.) in 100 μL of a chloroform–methanol solution (2:1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cleared biopsies were blocked for 3–4 h at room temperature (RT) or overnight at 4°C in blocking buffer (PBS (Sigma-Aldrich), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were washed twice with phosphate-buffered saline (PBS) and fixed by incubation in a phosphate buffer containing 3% paraformaldehyde (Sigma-Aldrich) for 25 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were lysed in 250 μl of buffer P1 by vortexing for 3 minutes in the presence of glass beads (G8772, Sigma-Aldrich). Then ...
-
bioRxiv - Systems Biology 2023Quote: ... the media was replaced by first washing twice with 3 mL DPBS+/+ (Phosphate buffered saline containing Mg++ and Ca++, Sigma, D8662) and then adding NDiff227 media (N2B27 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15N labelled protein was made from a 1 L culture containing M9 minimal media salts supplemented with 3 g of 13C-glucose (Sigma-Aldrich), 1 g of 15N ammonium chloride (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF10A JUN knockout cells expressing JUN-AID-V5 fusion protein and Transport inhibitor response 1 (TIR1) were grown to 60-70% confluency and treated with 100 µM indole-3-acetic acid (IAA, Sigma-Aldrich) for 1h to deplete JUN protein ...
-
bioRxiv - Neuroscience 2023Quote: ... Triton X-100 followed by blocking for 1hr in PBS containing 0.2% (v/v) Triton X-100 and 3% (w/v) bovine serum albumin (A9418 Sigma-Aldrich, UK). Primary antibodies for ALDH1A1 (PA5-32127 ...
-
bioRxiv - Physiology 2023Quote: ... BSA samples were transferred to Amicon ultra-0.5 mL centrifugal filter units with 3 kDa molecular weight cutoff (Millipore Sigma UFC5003) and filtered according to manufacturer instructions to collect posttranslationally modified BSA for secondary incubation.
-
bioRxiv - Physiology 2023Quote: ... in addition to silent mutations introducing a Mlu1 restriction enzyme recognition site to facilitate genotyping (5’ccacccgtcccctgagcctg aggggctccatgctgagcgtgcttccatccccagccaTTAttTacGCGTagcgcccagcagccatccattgtgccattcaca ccccaggcctacgaggag 3’; capital letters denote the mutated bases) (Sigma Aldrich). The gRNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... fixed in 40% isopropanol by three-minute incubation at room temperature and incubated with 3 mg/ml Oil Red O (Sigma, 09755) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were next incubated in 3 mL DME/F-12 medium with 2 units/mL DNase I (Sigma-Aldrich, D4263) at room temperature for 3 min and centrifuged at 450 g for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... single-cell suspensions of colon and spleen were stimulated for 3 h at 37°C with 50 ng/ml PMA (Sigma-Aldrich) and 1 μM ionomycin (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each well was then topped with 120 µL of PB(2×)M9 (various glucose concentration) and 10 µL of fluorescein (FITC)dextran (3 kDa, anionic, Sigma-Aldrich) solution in PBS to a total volume of 240 µL ...
-
bioRxiv - Plant Biology 2023Quote: ... Supernatants were incubated for 3-4 h at 4 °C with 15-20 μL of ANTI-FLAG® M2 Affinity Gel (Sigma) and washed 3-4 times with Co-IP wash buffer containing 0.1% Triton-100 but without Phosphatase Inhibitor Cocktails and Protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2023Quote: ... capsules were attached to the back of mice using a warmed adhesive solution made from 3 parts gum rosin (Millipore- Sigma) and 1 part beeswax (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... twice with wash buffer 3 (20 mM Tris-HCl pH 7.5, 2 M NaCl and 0.5% IGEPAL CA-630 [Sigma-Aldrich, cat#I8896]), and twice with wash buffer 4 (50 mM Tris-HCl pH 7.5) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times with 1x PBS and incubated until analysis in cell culture medium supplemented with gentamicin (Sigma, G1272). As positive control ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed 3 times with PBS for 10 min each and stained with DAPI (1:10000 of 5 mg/mL, Sigma-Aldrich) before mounted ...
-
bioRxiv - Neuroscience 2023Quote: ... Free-floating brain sections were then incubated for 1 hour at 4C in a blocking solution of phosphate-buffered saline (PBS) containing 3% bovine serum albumin (BSA, Sigma; A4503) (vol/vol ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 3 µl beta-mercaptoethanol per sample replaced 1,4-dithiothreitol (DTT) and 0.5% polyvinylpyrrolidone (PVP, mw 360 000, Sigma Aldrich, Steinheim, Germany) was added to the extraction buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the substrates were kept in a hermetically sealed case with a 50-ml aliquot of liquid silane (3-aminopropyl triethoxysilane, Sigma-Aldrich) at 70 °C for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The different polymers were incubated in the presence of 10 eq N-ethyl-N’-(3- (dimethylaminopropyl)carbodiimide (EDC) (Tokyo Kasei) and 15 eq N-hydroxysuccinimide (NHS) (Sigma-Aldrich) in water at pH 4.5 for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... the imidazole was removed by running the eluted sample on a 3 mL Sephadex G-50 size exclusion column (Sigma-Aldrich). The labeling yield was quantified by placing the sample in a 1 cm quartz cuvette in a Nanodrop 2000c UV-VIS spectrophotometer and measuring the absorbance spectrum between 190-840 nm ...
-
bioRxiv - Bioengineering 2022Quote: ... they are placed face down on a holding fixture within a glass jar with 50 uL of 3-Glycidoxypropyl trimethoxysilane (GPTMS) (Sigma Aldrich) at the bottom ...
-
bioRxiv - Developmental Biology 2023Quote: ... Gradual conversion of each sample to 1XPBT was performed using a diluted series of SSC/PBT and samples were blocked in blocking buffer for 3 hours at room temperature before adding 1:10000 of anti-DIG antibody (Millipore/Sigma) overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... A 5% (v/v) of washed >30 kDa FBS fraction was premixed with a 1:3 serial dilution of CaCl2 (#C5080, Sigma-Aldrich) diluted in 1X PBS (concentration range from 0.5 to 0 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested using Accutase (#LM-T1735, Biosera) and diluted in PBS with 3% fetal bovine serum (#FB-1101, Biosera) and 2mM EDTA (#ED2SS, Sigma-Aldrich) and immediately processed for measurements using CytoFLEX S flow cytometer (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... Triton-X 100 in PBS with 5 min incubation between each wash and blocked using 3% bovine serum albumin (BSA, A2058, Sigma-Aldrich) in PBS for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with fresh protease inhibitors (3 µg/mL Leupeptin, 1 µg/mL macroglobulin, 1 µM benzamidine, 0.5 µM PMSF) and phosphatase Inhibitors (EMD Millipore, 524625). Cell lysates were incubated 10 minutes on ice and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... at 4°C for 1 h followed by overnight incubation with 3 μL of the following antibodies: H3K4me2 (Millipore 07-030), H3K9me3 (Active Motif 39161) ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen cell pellets were resuspended in 200 μl of 20 % TCA on ice and lysed with vortexing for 3 minutes with acid-wash glass beads (Sigma-Aldrich). The glass beads were washed with 200 μl of 5% TCA twice and the crude extract was collected to a new tube ...
-
bioRxiv - Cell Biology 2023Quote: ... the column was washed with 20 column volumes of the lysis buffer and the protein was eluted with 3 mM desthiobiotin (Sigma, D1411).