Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... a 1:10,000 anti-rabbit dilution of IgG alkaline phosphatase was used before detection with NBP-BCIP (nitroblue tetrazolium chloride–5-bromo-4-chloro-3′-indolylphosphate; Sigma-Aldrich) as the substrate.
-
bioRxiv - Plant Biology 2021Quote: ... sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418, SIGMA)) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of the DIG-labelled probes was carried out by using an anti-DIG antibody coupled with alkaline phosphatase and a ready-to-use 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro-blue tetrazolium (NBT) solution (Sigma-Aldrich) as the chromogenic substrate for the enzyme ...
-
bioRxiv - Bioengineering 2022Quote: ... Bone-marrow derived hMSCs (hBMSCs) were frozen at passage 3 or 4 with 5*106 cells/ml in freezing medium containing FBS (BCBV7611, Sigma-Aldrich) with 10% DMSO and stored in liquid nitrogen until further use ...
-
bioRxiv - Developmental Biology 2020Quote: ... The staining reactions lasted between 2h and 8h at room temperature using nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3′-indolyphosphate (BCIP) staining reactions (Sigma Aldrich). Embryos were then rinsed in PBS-T (0.05% Tween-20) ...
-
bioRxiv - Plant Biology 2020Quote: ... and placed in Petri dishes filled with 0.5% agarose containing 35 mM β-mercaptoethanol (v/v) and 1.5 mg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Sigma). For X-gal staining ...
-
bioRxiv - Microbiology 2022Quote: ... Detection was performed by colorimetry using nitro blue tetrazolium chloride / 5-bromo-4-chloro-3-indolyl-phosphate (NBT-BCIP, Sigma-Aldrich) as a substrate.
-
bioRxiv - Neuroscience 2024Quote: ... The medium was changed every 3–4 d and enriched with granulocyte-macrophage colony-stimulating factor (5 ng/ml GM-CSF, Sigma-Aldrich). After approximately 14 d at 37°C and 5% CO2 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-4 µL was separated using a Millipore SeQuant ZIC-pHILIC (2.1 × 150 mm, 5 µm particle size, Millipore Sigma #150460) column with a ZIC-pHILIC guard column (20 x 2.1 mm ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL betaine (5 M, Sigma-Aldrich), 0.23 μL magnesium chloride (1 M ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4-AP (5 mM; Sigma-Aldrich) to isolate monosynaptic responses ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µM of 4-NQO (Sigma-Aldrich) was added to cell culture media for 4 hr before cell harvest.
-
bioRxiv - Microbiology 2023Quote: ... 5 ng/ml IL-4 (Sigma I1020), and 20 µg/ml LPS (Sigma L-2630) ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5 M Betaine (Sigma-Aldrich), 6.4 μL Water ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Immunology 2022Quote: ... spleens were fixed for 2 h at 4°C in 2 mL of 4% paraformaldehyde (Millipore Sigma) followed by an overnight incubation at 4°C in 2 mL of 30% sucrose (Millipore Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 2 h or 4-hydroxytamoxifen (4-OHT, Sigma, 10 µM) for 4 h ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Developmental Biology 2020Quote: Tadpoles were anesthetized at room temperature by incubation for 30-60 seconds in a 1:2000 dilution of MS222 (ethyl 3-aminobenzoate methanesulfonate, Sigma, St. Louis, MO) diluted in 1/20X Normal Amphibian Media ...
-
bioRxiv - Zoology 2022Quote: The frogs underwent double euthanasia according to institutional ethics guidelines under ethics approval number NWU-00380-16-A5-01: first anaesthesia in 6% ethyl-3-aminobenzoate methansulfonate (MS222) (Sigma-Aldrich Co., USA) and then euthanasia through pithing.
-
bioRxiv - Molecular Biology 2022Quote: Embryos at stage 29-31E (before the pre-hatching period) were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate (MS-222) (Sigma-Aldrich, St. Louis, MO) in natural seawater and sacrificed by decapitation ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 µM 5-Fluoro-20-deoxyuridine (FDU) and 4 µM Uridine (Sigma). On day 8 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4 mM 4-Nitrophenyl acetate (Sigma-Aldrich; Cas: 830-03-5) in a buffer containing 100 mM NaCl and 50 mM sodium phosphate ...
-
bioRxiv - Bioengineering 2023Quote: ... connected to the cartridge using a PEEK (Polyether ether ketone) tube (i.d. 0.75 mm, Sigma Aldrich). The overall setup is immobilized using a retort stand and the inlet tube is clamped before pouring the sample into the top reservoir ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and pMCAo-21d group received 4 intraperitoneal injections of 50 mg/kg of 5-Chloro-2′-deoxyuridine (CldU, Sigma). The injections were administered 6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Chemical compounds were first identified using the NIST library and later confirmed with co-elution of synthetic 4-methyl-3-heptanone (Pfaltz and Bauer M19160) and 4-methyl-3-heptanol (Sigma Aldrich M48309). Compounds eluting after 30 minutes were excluded from the analysis due to lack of volatility.
-
bioRxiv - Developmental Biology 2022Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 µl of a solution of 5 mg/mL MTT [3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma Chemical Co.) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were exposed to 5 μM CHIR99021 (Axon) between days 2 and 3 and then supplemented with 100 nM RA (Sigma) until day 5 ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... 3 µL of 2 M CaCl2 and 5 µL of 10 mg/mL ε-aminocaproic acid (ε-ACA) (Sigma-Aldrich), and 1 µL of 1U/µL Thrombin (MP Biomedicals ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Microbiology 2024Quote: ... Each extract was resuspended in 170 µL of 100% methanol containing isotopically labeled internal standards (5-50 µM of 13C,15N Cell Free Amino Acid Mixture, #767964, Sigma; 1 ug/mL 2-amino-3-bromo-5-methylbenzoic acid, ABMBA, #R435902, Sigma) and centrifuge-filtered (0.22 µm hydrophilic PVDF membrane ...
-
bioRxiv - Pathology 2024Quote: ... infiltrated leaves were treated with PBS buffer containing 2% dimethyl sulfoxide (DMSO; control) or an equal volume of DMSO with 5 mM 3-MA (Sigma) for inhibition of autophagy ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then stained for 2 minutes at room temperature using filtered 0.5% Solvent Black 3 (CAS Number 4197-25-5; Sigma 199664) dissolved in 75% ethanol ...
-
bioRxiv - Immunology 2022Quote: ... a solution of 750 mM ethyl palmitate (Millipore Sigma), 1.6% lecithin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... and 500 µL ethyl acetate (Sigma-Aldrich, cat # 270989) and vortexed for 2 min ...