Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2020Quote: ... 6–8-week-old C57BL/6N mice were anesthetized by inhalation of isoflurane (3–4%) or intraperitoneal injection of 2% Avertin solution (2,2,2-tribromoethyl alcohol dissolved in Tert-amylalcohol (Sigma)) dissolved in saline ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Neuroscience 2020Quote: PF-4778574 [N-<(3R,4S)-3-[4-(5-cyano-2-thienyl)phenyl]tetrahydro-2H-pyran-4-yl>propane-2-sulfonamide] was obtained as a powder from Sigma (catalog #PZ0211) and solubilized (2.5 mg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 μM hydrogen peroxide (H2O2) for 5 min or alkylated with 20 mM N-ethyl maleimide (NEM; Sigma #E3876) in 100 mM sodium phosphate ...
-
bioRxiv - Microbiology 2022Quote: ... The hydrogel was then prepared by slowly adding 5 g hydroxy ethyl cellulose (Sigma Aldrich, St. Louis, Missouri, USA) under constant ...
-
bioRxiv - Immunology 2021Quote: ... 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (BCIP /NBT) liquid substrates for AP-enzyme (SIGMA) were added for overnight incubation at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 250 µL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) (20 mg/ml) (Sigma-Aldrich, UK) and Isopropyl ß-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell disruption was carried out by vortexing (3 cycles, 5 min each) at 4°C using 0.2 ml of glass beads (425-600 μm; Sigma). For the Rpb3 immunopurification ...
-
bioRxiv - Cell Biology 2022Quote: ... was revealed with 5-bromo-4-chloro-3-indolyl β-D galactoside (X-gal) (Sigma-Aldrich, Carlsbad, CA, USA). Diploid cells were grown on SC medium supplemented with 20 mg/L adenine hemisulfate ...
-
bioRxiv - Microbiology 2024Quote: ... Coloring reactions were performed with nitro blue tetrazolium/5-Bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution (Sigma), and then sections were washed in PBS ...
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 µg/mL N-tosyl-L-phenylalanine chloromethyl ketone-trypsin (TPCK-trypsin, Sigma) and titered by viral plaque assay using MDCK cells as previously reported [29] ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-fluoro-2’-deoxyuridine (Sigma, 5 μM) were added to the culture medium at days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-hydroxy-4’-(2- hydroxyethoxy)-2-methylpropiophenone (I2959) (Sigma-Aldrich, USA), a photoinitiatior (0.5% w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Cell Biology 2021Quote: ... The parasites (ring stage; 2-4 hpi) were tightly synchronized with 5% (v/v) D-sorbitol (Sigma) and then monitored by Giemsa staining of methanol-fixed blood smears ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Day 4 and Day 8 were treated with 10 μM 5-bromo-2’-deoxyuridine (BrdU) (Sigma-Aldrich) for 1 hour at 37 °C in a CO2 incubator ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated overnight in EtOH 100% at 4°C prior to clearing with ethyl cinnamate (Sigma, 112372-100G) at RT for at least 2 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... linalyl acetate (LA, 4), (2E,4E)-2,4-octadienal (OCT, 39) and ethyl cinnamate (EC, IV) were purchased from Sigma Aldrich; isopropyl cinnamate (IPC ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... After 24 h media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37°C in 5% CO2 for 3 h ...
-
bioRxiv - Immunology 2021Quote: ... larvae were anesthetized in E3 media without methylene blue supplemented with 0.16 mg/ml Tricaine (MS222/ethyl 3-aminobenzoate; Sigma-Aldrich-Aldrich).
-
bioRxiv - Genomics 2020Quote: Zebrafish embryos/larvae were euthanized by prolonged immersion in 200-300 mg/L tricaine (MS222; ethyl-3-aminobenzoate methanesulfonate, #E10521-10G, Sigma-Aldrich). Whenever necessary the chorion was removed ...
-
bioRxiv - Neuroscience 2020Quote: ... Stages VI oocytes from Xenopus tropicalis anesthetized by 0.4% ethyl 3-aminobenzoate methanesulfonate (MS-222)(Sigma-Aldrich; St. Louis, Missouri, USA) were prepared by treatment with 0.1 mg/ml collagenase (Worthington ...
-
bioRxiv - Immunology 2021Quote: ... cells were removed and plates were incubated with biotinylated detection antibodies and Streptavidin-HRP conjugate following the manufactures introductions using a 1 in 100 dilution for the streptavidin-HRP conjugate with 3-Amino-9-ethyl-carbazole (AEC; Sigma-Aldrich) dissolved in N,N-dimethylformamide (Merck Millipore ...
-
bioRxiv - Biophysics 2021Quote: ... injected embryos were manually dechorionated and anesthetized by incubation with 0.14 mg/ml Tricaine (Ethyl 3-aminobenzoate methanesulfonate; A5040, Sigma-Aldrich, USA).