Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The different polymers were incubated in the presence of 10 eq N-ethyl-N’-(3- (dimethylaminopropyl)carbodiimide (EDC) (Tokyo Kasei) and 15 eq N-hydroxysuccinimide (NHS) (Sigma-Aldrich) in water at pH 4.5 for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1µM 4-hydroxy 5-methytetrahydrofolate (SIGMA).
-
bioRxiv - Molecular Biology 2022Quote: ... IL-4 (5 ng/ml; Sigma) 0.5 μg/ml of anti-CD180 (RP105 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL IL-4 (Sigma), and 0.5 ug/mL anti-CD180 (BD Pharmingen ...
-
bioRxiv - Immunology 2023Quote: ... 4 μl betaine (5 M, Sigma), 0.12 μl MgCl2 (1 M ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-OHT (5 µM; Sigma-Aldrich), Dp44mT (5 μM) ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were dehydrated in increasing concentrations of ethanol for 5 min each (2 × 35%, 50%, 70%, 80%, 90%, 3 × 100%) and washed 3 x 5 min with propylene oxide (Sigma- Aldrich, #cat 110205-18L-C). Sections were next embedded overnight at RT in Durcupan resin (20g component A ...
-
bioRxiv - Bioengineering 2020Quote: ... O,O′-bis[2-(N-succinimidyl-succinylamino)ethyl]polyethylene glycol with molecular weight of 2kDa (NHS-PEG-NHS, Sigma) was mixed with the protein solution at 10 w/w% ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... cinnamon) or a pair of pure monomolecular odorants (ethyl butyrate, valeraldehyde, isoamyl acetate, ethyl tiglate, hexanone or cineole, Sigma-Aldrich). Pure odorants were diluted 1:10 in 10mL mineral oil and natural odorants were presented in their native state ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... coli DH5α cells were transformed with the resulting pho-lac fusion plasmids and streaked on dual indicator plates containing LB agar with 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) (Sigma) at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoreactive bands were detected by the addition of BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was stopped after 2 min by washing the blots with large volumes of deionized water.
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were cultivated under humidified conditions with 5% CO2 at 37°C and passaged every 3-4 days using 0.05% trypsin/EDTA (Sigma-Aldrich). Cells were harvested in ice-cold PBS buffer using a cell scraper ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Bioengineering 2021Quote: ... was reconstituted in ethyl alcohol (Sigma-Aldrich 459844) and added to cell-culture media at a concentration of 0.5 µg/mL for 30 minutes to disrupt actin filaments ...
-
bioRxiv - Neuroscience 2020Quote: ... PX-ethyl was purchased from Sigma (United States), according to Sigma safety data sheet safety measures of eyeshields ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ethyl acetate (Catalog no. 270989, Sigma-Aldrich). 8-isoprostane was measured following manufacturer’s protocol with the adjustment for low sample volume ...
-
bioRxiv - Microbiology 2022Quote: ... and 70 µL of Ethyl Acetate (Sigma; 439169) were added and samples were incubated in a thermomixer at 70°C for 1 hour and 1400rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... and then treated with ethyl acetate (Sigma–Aldrich) in 10% TFA to remove detergents ...
-
bioRxiv - Genomics 2021Quote: ... in ethyl alcohol (Sigma-Aldrich, Cat. Num. 459836), 6 mL propionic acid (Sigma-Aldrich ...
-
Effects of stimulus timing on the acquisition of an olfactory working memory task in head-fixed micebioRxiv - Neuroscience 2022Quote: ... Ethyl butyrate (W242705) was purchased from Sigma-Aldrich and methyl tiglate (T0248 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Ethyl maltol stock was purchased from Millipore Sigma and resuspended in DMSO for cell culture use ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Grids were washed with ethyl acetate (Sigma Aldrich) and then glow-discharged at −20 mA for 60 seconds with a Pelco Easiglow ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 70 μL of ethyl acetate (Sigma; 439169) were added and samples were incubated in a thermomixer at 70 °C for 1 hour and 1400 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 mL of ethyl acetate (>99.9% Sigma-Aldrich) and 0.5% (v/v ...