Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were also washed for 10 minutes in a solution of 1.25×10−3 mg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Sigma: D9542) in PBS to fluorescently label nuclei within tissue sections.
-
bioRxiv - Immunology 2024Quote: ... a subset of the mice (n = 3-4 per group) received intraperitoneal (i.p.) injections of 2 mg/kg WFA (Millipore-Sigma, #681535), or equivalent volume of the vehicle (VC ...
-
bioRxiv - Bioengineering 2024Quote: ... and polyIC incubation was evaluated using the MTT (3-(4, 5dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). The cells were seeded into 96 well-format cell culture plates at a seeding density of 8ξ103 cells per well ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium-3-methyl-2-oxobutyrate (ketovaline, Sigma), 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Microbiology 2020Quote: ... indole-3-actic acid (Sigma, 2 mM) were freshly prepared for serial dilutions (10x ...
-
bioRxiv - Neuroscience 2022Quote: ... phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates sat on ice for 30min with intermittent vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-methylene-2-norbornanone (Sigma; Cat# M46055), lumiflavin (Cayman Chemical ...
-
bioRxiv - Developmental Biology 2023Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma) and benzonase (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and phosphatase inhibitors 2 and 3 (Sigma). Lysates incubated on ice for at least 20 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1% phosphatase inhibitor cocktail 2 & 3 (Sigma) and protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... β2/3 subunit (Millipore, catalog #: 05-474) (1:250 dilution) ...
-
bioRxiv - Immunology 2024Quote: ... and phosphatase inhibitors 2 and 3 (Sigma). Samples were left on ice for 30 min with vortexing every 5 min to disrupt membranes and then centrifuged at 13,200 rpm at 4°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... phosphatase inhibitor cocktails 2 + 3 (Sigma Aldrich), and protease inhibitor tablet (ThermoScientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM Ca(NO3)2 ×24H2O (13477-34-4, Sigma), 2.5 mM KH2PO4 (7778-77-0 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Neuroscience 2020Quote: ... The signal was determined by nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (toluidine salt) (BCIP) (Sigma, 72091).Semithin sections for toluidine blue myelin staining and ultrathin section for TEM imaging were prepared according to our previous protocols (Zhang et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 60°C and developed using nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Sigma Aldrich) for 60 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fertilized oocytes were collected from 3-4 week-old superovulated C57Bl6 females prepared by injecting 5 IU each of pregnant mare serum gonadotrophin (PMSG) (Sigma Aldrich) and human chorionic gonadotropin (hCG ...