Labshake search
Citations for Millipore Sigma :
5351 - 5400 of 5994 citations for Rat TNF alpha ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... alkaline phosphatase staining was completed within each well using a commercially available Leukocyte Alkaline Phosphatase staining kit (Sigma Aldrich 86R-1KT). Whole well images were collected through brightfield microscopy and quantification of colony forming units (CFUs ...
-
bioRxiv - Cell Biology 2021Quote: ... and Spo74-mScarlet were generated at their endogenous genome locus by transformation with PCR tagging cassettes of indicated C-terminal tags using the PEG/lithium acetate yeast transformation kit (Millipore-Sigma, YEAST1). Plasmids with 2XGFP-Atg8 in pRS303 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from 4-day-old dark-grown seedlings plus 3hrs light treatment using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). One microgram of total RNA was treated with DNase I to eliminate genomic DNA and then reverse transcribed using SuperScript III (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from the frozen tissues using Spectrum™Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... pLysS cells expressing His-topoIB and T18 tagged genome segregation proteins in different combinations using the kit Protein G immunoprecipitation from Sigma-Aldrich as described previously (Maurya et ...
-
bioRxiv - Plant Biology 2020Quote: ... we extracted total RNA from pools of 6-8 shoot apical meristems (SAM) after the terminal spikelet stage from four biological replicates using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). The cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 100 mg of ground-frozen samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich) and the RNA purity was determined through NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 30 μL of samples and standards were added to a 96-well plate and glucose was measured using the Glucose Oxidase (GO) Assay kits (Sigma, GAGO20). Total circulating sugars was measured from the trehalase-treated sample ...
-
bioRxiv - Physiology 2020Quote: ... 1971), MJF465 (Levina, 1999), MJF641, and MJF516 (Edwards et al., 2012) was performed using the Novagen λDE3 Lysogenization Kit (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from 7-d-old Emmenanthe penduliflora seedlings grown in 16:8 photoperiod on moistened filter paper using Spectrum Plant Total RNA kit (Sigma-Aldrich) after removal of seed coats ...
-
bioRxiv - Microbiology 2019Quote: ... and the molecular sizes of each fraction was estimated by gel filtration molecular weight markers (Kit No: MWGF1000 of Sigma-Aldrich), and each fraction was collected for protein identification by Western blot.
-
bioRxiv - Cell Biology 2021Quote: ... The TUNEL assay was performed on the testis sections (5 μm) with ApopTag plus peroxidase in situ apoptosis detection kit (Millipore, S7101).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed with 2% paraformaldehyde in PBS and proximity ligation assays (PLA) were performed with the Duolink In Situ Red Starter Kit Mouse/Rabbit (Sigma Aldrich) according to the manufacturer’s protocol.
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... The EV pellet was resuspended in 200 μl of filtered PBS and stained by using the PKH26 Red Fluorescent Cell Linker Kit for General Cell Membrane Labelling (Sigma-Aldrich). The dye solution was freshly prepared by adding 4 μl of PKH26 dye to 1 ml of Diluent C ...
-
bioRxiv - Cell Biology 2020Quote: ... Medium was changed every 24 h and plates were stained for alkaline phosphatase activity to assure the efficiency of reprogramming (AP detection kit, Sigma-Aldrich). Once colonies were picked ...
-
bioRxiv - Biophysics 2021Quote: CoA levels in the protein solution after proteinase K digestion were quantified using a commercial CoA assay kit according to manufacturer’s protocol (Sigma-Aldrich; MAK034). CoA concentration is determined by an enzymatic assay ...
-
bioRxiv - Cell Biology 2021Quote: RAW 264.7 cells were grown and used according to manufacturer’s instructions to obtain membrane fractions by differential sedimentation ultracentrifugation using a density gradient (Lysosome Isolation Kit, Sigma-Aldrich, LYSISO1). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained for proximity ligation assay (PLA) using a Duolink® kit according to the manufacturer’s protocol (DUO92101, Millipore Sigma). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... media was removed from wells and cells were incubated with MTT from the Cell Proliferation Kit (Sigma Aldrich, catalogue no. 11465007001), and the colorimetric assay was performed following manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... The fraction of proteins >1 kDa was obtained by dialysis using the Mini Dialysis Kit 1 kDa (Sigma #GE80-6483-94). All kits were applied according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... CHO CoV-2-Spike cells were used as target cells and were fluorescently labeled with PKH67 Fluorescent Cell Linker Kit (Sigma Aldrich) prior to incubation with mAbs ...
-
bioRxiv - Physiology 2022Quote: Determination of cellular total iron levels in magnetically-sorted RPMs was carried out using the Iron assay Kit (Sigma-Aldrich, MAK025) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: PLA was carried out on 4% paraformaldehyde-fixed PS and PSP cells using the Duolink PLA Kit (Sigma-Aldrich, DUO92101-1KT) following the manufacturer protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... and cDNA fragments were amplified by PCR according to the manufacturer’s protocol (GenomePlex Single Cell Whole Genome Amplification Kit, Sigma Aldrich WGA4). The amplified libraries were run on a bioanalyzer to assess quality (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Osteoclast resorbed surface (Oc.S/BS) was measured following TRAP staining with Leukocyte Acid Phosphatase TRAP Kit (Sigma Aldrich, catalog # 387A-1KT). RNA was extracted from isolated whole femur for qPCR for osteoblast (Col1a1 ...
-
bioRxiv - Cell Biology 2022Quote: ... ear notches were collected from mouse pups to extract genomic DNA using the RED Extract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Ear notches were incubated in the tissue preparation (25 μl/sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells of the granulocytic lineage were stained on paraffin embedded tissues with the Napthol AS-D Chloracetate (Specific Esterase, CAE) Kit (Ref: 91C-1KT, Sigma-Aldrich) according to the manufacturers protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... The measurement of total glutathione (tGSH) was determined (in pellets and supernatants) using the kinetic glutathione assay kit (Sigma-Aldrich, Spain) in which catalytic amounts (nmoles ...
-
bioRxiv - Biochemistry 2022Quote: K562 cell line derivatives were collected by centrifugation at 1400 x g for 3 mins and nuclei were isolated using the Nuclei EZ Prep nuclei isolation kit (Sigma- Aldrich). The nuclei were fixed in 4% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: To quantify extracellular levels of lactate and pyruvate from iHep supernatants aliquots were taken at day 22 of differentiation and analyzed using Lactate and Pyruvate Assay Kits (Sigma-Aldrich) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... PLA was performed using the Duolink in situ PLA kit according to the manufacturer’s instructions (Millipore Sigma, DUO92002, DUO92004 and DUO92014). In brief ...
-
bioRxiv - Cancer Biology 2022Quote: RAS and RAC activity were measured using a RAF-1 RBD and PAK-1 PDB pull-down assay kits respectively (Cat#17218 and Cat#14325, Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The precipitated proteins were used for determination of protein content using a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich, Taufkirchen, Germany).
-
bioRxiv - Microbiology 2021Quote: ... for pathological examination.Paraffin-embedded lung tissue sections were also stained for the presence of fungal structures using the Silver Stain Kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total carbohydrate was determined by the Dubois phenol-sulfuric acid method (76) adapted to a 96-well plate assay with the Total Carbohydrate Assay Kit (MAK 104, Sigma-Aldrich), using D-glucose as the standard and absorbance read at a wavelength of 490 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... avidin biotin was added to attach peroxidase (ABC kit; Vector, PK-4000) and sections reacted with DAB and urea peroxidase (Sigmafast, D4293, Sigma Aldrich) until the reaction product was clearly visible.
-
bioRxiv - Microbiology 2021Quote: ... DNA was then extracted from 2 mL of cell culture using a GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, USA). DNA samples were subjected to an initial quality check using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then biotinylated by click-it reaction according to the manufacturer protocol (Click-iT® Nascent RNA Capture Kit; Life technology) and precipitated with EtOH (Sigma) and Na-acetate (Gibco) ...
-
bioRxiv - Genomics 2020Quote: Nuclei were isolated from ~100mg of frozen frontal cortex brain tissue from Brodmann area 9 at the HIHG using the Nuclei Isolation Kit: Nuclei EZ Prep (Sigma, #NUC101). All tissues were homogenized in ice-cold EZ Lysis buffer with a glass-on-glass dounce homogenizer ...
-
bioRxiv - Microbiology 2021Quote: Cell viability and cytotoxicity of antibiotics and peptides were determined against human corneal epithelial cells (HCE-2, CRL-11135, ATCC, Manassas, Virginia, USA) using cell-counting-kit-8 (CCK-8) assay (Sigma Aldrich, Merck Life Science UK Limited ...
-
bioRxiv - Microbiology 2021Quote: ... We then used these primers (TTCGTCGTGAGACAGAGCGG, AGGCCATTGACGGATGGTTTGTAC) to amplify DNA from the two positive mosquitoes using the Expand™ Long Range dNTPack kit (Sigma) using the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: Genomic DNA from all the endpoint populations was extracted using GenElute Bacterial Genomic DNA Kit (NA2120; Sigma-Aldrich, St. Louis, MO) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Protein concentration was determined by the bicinchoninic acid protein assay kit (BCA-Pierce, USA) using bovine serum albumin (BSA, Sigma-Aldrich) as standard.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was removed and the cell pellet was resuspended in 500 μL Diluent C containing 2 μL PKH67 dye (PKH67 Green Fluorescent Cell Linker Kit, Sigma-Aldrich), incubated for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... samples were centrifuged at 10,000g for 5 min and the Acetyl-CoA measurement was performed in a 96-well plate using the Acetyl-Coenzyme A Assay Kit (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Lactate dehydrogenase (LDH)-based cytotoxicity levels were determined by evaluation of LDH release into the cell culture supernatants using Lactate Dehydrogenase Activity Assay kit (MAK066, Sigma-Aldrich). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Methylated mRNA was eluted by free m6A from the beads and purified with the GenElute™ mRNA Miniprep Kit (MRN70, Sigma). One tenth of the fragmented RNA was saved as an input control for standardization ...
-
bioRxiv - Biochemistry 2021Quote: ... after 4 hours cells were fixed in 3.7% paraformaldehyde/30 mM sucrose for 10 min and processed either for the is-PLA experiment by using the Duolink PLA kit (DUO92007, Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: MCDK cell viability following exposure to GO-AgNP supernatants or vehicle was assessed using a Cytotoxicity Detection Kit (Millipore Sigma #11644793001). Prior to testing ...