Labshake search
Citations for Millipore Sigma :
5001 - 5050 of 10000+ citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... 150 mM NaCl, 1% Triton-X100, 1X Complete protease inhibitor cocktail [Roche], 1X phosphatase inhibitor cocktails 2 and 3 [Sigma]). Protein concentration was determined using BCA assays (Pierce Biotech).
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Plant Biology 2020Quote: ... were isolated from 2-week-old dPPRrbcL-1 or Col-0 plants and incubated with monoclonal anti-HA antibodies (Sigma). IgGs were captured with Protein A DynaBeads (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Microbiology 2020Quote: ... or 40 µg/ml of trimethoprim-sulfamethoxazole (SXT) at a ratio of 1:19 (2 µg/ml of trimethoprim and 38 µg/ml of sulfamethoxazole; Sigma) as a positive control ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The GC cell pellet was further suspended in 1-2 ml of serum free Dulbecco’s Modified Eagle Medium (DMEM) (Sigma, U.S.A) supplemented with 3 mM/ml of L-glutamine (Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: 6 dpf Cntnap2a-positive fish were treated for 1 hour with 0.05% DASPEI (2-4-dimethylamino-N-ethylpyridinium iodide; Sigma Aldrich), which labels both superficial and canal neuromasts [46] ...
-
bioRxiv - Microbiology 2019Quote: ... PfCERLI1HAGlmS parasites were transfected with the an episomal cytosolic GFP expressing plasmid pHGBrHrBl-1/2 and maintenance of this plasmid was selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). Maintenance of the SLI-TGD plasmid was selected for using 20 μM WR99210 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... washed in dilutions of SSC (2x and 0.2x) and TNT prior to blocking (1-2 hours in blocking solution of 5% heat-inactivated horse serum (Millipore Sigma), 0.5% Western Blocking Regent (Millipore Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... from Tocris CGP-55845 ((2S)-3-[[(1S)-1-(3,4-Dichlorophenyl)ethyl]amino-2-hydro xypropyl](phenylmethyl)phosphinic acid hydrochloride) from Sigma-Aldrich
-
Myofiber injury induces capillary disruption and regeneration of disorganized microvascular networksbioRxiv - Physiology 2021Quote: ... The membrane permeant nuclear dye Hoechst 33342 (1 µM; #H1399, Fisher) was used to identify nuclei of all cells and propidium iodide (2 µM, #P4170, Sigma) to identify nuclei in dead and dying cells (14 ...
-
bioRxiv - Biochemistry 2021Quote: ... tRNA was incubated with 1/10 volume of 0.1 M ammonium acetate and nuclease P1 (2 U/µg tRNA, Sigma-Aldrich) at 45°Cfor 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Input (2%) and bound (100%) fractions were resolved by SDS-PAGE and immunoblotted with HA (1:2,000, H3663, Sigma-Aldrich), GFP (1:4,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fertilized embryos (1-cell and 2-cell stage) were selected for culture in M16 medium (Sigma-Aldrich, MR-016-D) under mineral oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... immersion for delipidation was followed by indefinite immersion in BABB (benzyl alcohol + benzyl benzoate 1:2, Sigma, 24122 and W213802) solution for refractive index matching.
-
bioRxiv - Bioengineering 2021Quote: The collected BMOs were fixed with 2 % paraformaldehyde (PFA, ThermoFischer Scientific, 15434389) for 1 h and permeabilized with 0.3 % Triton-X-100 (Sigma, T8787) in PBS for 3 h at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 0.33 mM MgSO4) in the presence of 150 mM of 1-phenyl-2-thiourea (PTU) (Millipore Sigma, Burlington, MA) to prevent pigment formation ...
-
bioRxiv - Cell Biology 2021Quote: ... were resuspended in DPBS at 2 - 5 million cells per ml and incubated with 1 µl (25 - 29 U) benzonase (Millipore) at 37 °C for a minimum of 1 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... subjected to freeze/thaw at -80°C, and sonicated in lysis buffer (1x PBS, 1% CHAPS, 10mM MgCl2, 2 µl benzonase (25 U/µl, Millipore), and protease inhibitor (Thermo Scientific)) ...
-
bioRxiv - Microbiology 2021Quote: ... harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG). SARS-CoV and MERS-CoV viral stocks were generated by infecting VeroE6 cells (MOI 0.0001 ...
-
bioRxiv - Microbiology 2022Quote: ... was diluted to 1 μg/mL in 1% goat serum in PBS with 100 ng/mL of 4’6-diamidino-2-phenylindole (DAPI; Millipore Sigma) and added to cells for 60 min at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 58°C for 2 hr post fixation and subsequently immersed in 1% phosphomolybdic acid (Sigma, St Louis, MO, USA) and 0.5% phosphotungstic acid solution (Sigma ...
-
bioRxiv - Genomics 2022Quote: ... Induction of DUX4 and SRSF3 transgenes was achieved by culturing cells in 1-2 μg/mL doxycycline hyclate (Sigma-Aldrich). Differentiation of myoblasts into myotubes was achieved by switching the fully confluent myoblast monolayer into DMEM containing 1% horse serum (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was transferred to a fresh tube and reduced with 1 mM Tris 2-carboxyethyl phosphine hydrochloride (TCEP, Sigma) for 30 minutes at 60°C and alkylated in 4 mM methyl methanethiosulfonate (MMTS ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells (2 × 15 cm plates) were incubated for 24 hours in complete media supplemented with 1 μg/ml tetracycline (Sigma) prior to harvesting similar to the BioID group.
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Biochemistry 2022Quote: ... Around 3 g of cells were suspended 1:5 in 50 mM Mops/KOH pH 7.0 supplemented with 2 mM dithiothreitol (DTT, Sigma-Aldrich) and disrupted by sonication while in an ice bath using a SONOPULS GM200 (Bandelin ...
-
bioRxiv - Biochemistry 2022Quote: ... and cell pellets were collected and resuspended in the resuspension buffer containing 20 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Sigma) pH 7.4 and 200 mM NaCl (Sigma)] ...
-
bioRxiv - Biochemistry 2022Quote: ... and serially diluted in DMEM media and incubated in 24-well plates with a semi-confluent culture of Vero cells (for ZKV samples) for 1 h at 37°C and covered with DMEM 2% fetal bovine serum + 0.8% of methylcellulose (Sigma, M0512) overlay for 4 days at 37°C and 5% CO2 incubator ...
-
bioRxiv - Neuroscience 2022Quote: ... Detection was carried out using anti-mouse IgG-HRP antibody (GE; 1:5000 in PBS + 2% BSA) followed by addition of TMB substrate (Sigma). Reaction was stopped by adding 0.5 M H2SO4 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... then mixed with 1 mL of the reactive dye 5-([4,6-dichlorotriazin-2-yl]amino)fluorescein hydrochloride (DTAF) (Sigma Aldrich), previously dissolved in DMSO (20 mg/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Plant Biology 2022Quote: ... and incubated for 8 h followed by treatment with 5 μM EPFL6 for 1 h in the presence of 2 μM MG132 (Sigma). The ubiquitinated ERECTA was detected with an α-HA (ab18181 ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was changed to Ngn2-medium (Table 1) and cytosine b-D-arabinofuranoside (Ara-C) (2 μM; Sigma, C1768) was added once to remove proliferating cells from the culture ...
-
bioRxiv - Neuroscience 2023Quote: 1×109 particles/ml EMVs and EEXs were pre-incubated with PKH 26 dye (2 μM, Sigma, USA, cat# PKH26GL) [57] ...
-
bioRxiv - Neuroscience 2022Quote: Quantitative PCRs were run using qPCRBIO SyGreen mix separate-Rox (cat #: PB20.14-51 PCRBIOSYSTEMS) and specific primers (Table 1; Table 2) or Gapdh as housekeeping gene (Sigma-Aldrich), on a LightCycler 96 Real-Time PCR System (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... peptides were acidified with 2 μl of 1% TFA then desalted using C18 ZipTips® (Millipore, cat no. Z720070-96EA).
-
Nerve pathology is prevented by linker proteins in mouse models for LAMA2-related muscular dystrophybioRxiv - Neuroscience 2022Quote: ... All zygotes were collected from oviducts 24 h after the human chorionic gonadotropin injection and were then freed from any remaining cumulus cells by a 1-2 min treatment of 0.1% hyaluronidase (Sigma-Aldrich) dissolved in M2 medium (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were blocked for 1 hour with blocking buffer (Cyto-TBS + 2% bovine serum albumin (BSA, Sigma Aldrich, 1002695029)) and incubated with a primary antibody overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... XAV939 (1 μM, Stemgent, 04-00046) and LDN-193189 (50 nM, Stemgent, 04-0074) with doxycycline hyclate (2 μg.mL−1, Sigma, D9891) and Zeocin (1 μg.mL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Stemgent, 04-00046) and LDN-193189 (100 nM, Stemgent, 04-0074) along with doxycycline hyclate (2 μg.mL−1, Sigma, D9891) with Y27632 (5 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was incubated (1 h, 50°C) with 2 µL 10% SDS and 5 µL proteinase K (10 mg/mL, Sigma). Chromatin was recovered by phenol/chloroform extraction and resuspended in 30 µL TE (1 mM tris-HCl pH8.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were harvested and pelleted before being suspended in a formaldehyde-reversal lysis buffer containing 500mM Tris + 150mM NaCl + 1% Triton X-100 + 2% SDS + 50mM 1,4-dithiothreitol (DTT) + 1X cOmplete EDTA-free Protease inhibitor cocktail (Sigma-Aldrich), pH 8 ...
-
bioRxiv - Neuroscience 2024Quote: ... Goat anti-ChAT (1:200, Millpore) diluted in PBS supplemented with 2% horse serum and 0.1% triton X-100 (Sigma-Aldrich) were applied onto the sections followed by overnight incubation at 4°C in a humidified chamber ...
-
bioRxiv - Immunology 2024Quote: ... 1 mg of as-synthesized SWCNT powder was added to 2 mg of (GT)xx oligonucleotide (Integrated DNA Technologies) 1 mL of 0.1 M NaCl (Sigma-Aldrich). Each sample was ultrasonicated using a 1/8′′ tapered microtip for 30 min at 40% amplitude in an ice bath (Sonics Vibracell VCX-130 ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed with PBS and permeabilised with 0.3% Triton X-100 for 10 min and blocked for 1 h at RT with 2% bovine serum albumin (BSA, Sigma)/2% normal goat serum (GS ...
-
bioRxiv - Neuroscience 2024Quote: ... media was changed once per week with the addition of 1 μM 5-Fluoro-2′-deoxyuridine (Cat.#F0503, Sigma-Aldrich) and 1 μM Uridine (Cat.#U3003 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were re suspended in FACS buffer (0.1% BSA in PBS and 2% FBS) containing 50µg/ml of DNase 1 (Sigma D-4513) to reduce clustering of cell samples ...