Labshake search
Citations for Millipore Sigma :
4901 - 4950 of 10000+ citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Plasma levels of counter-regulatory hormones and GHRH levels in cell supernatant were determined by ELISA (Crystal Chem Glucagon 81518; Corticosterone 80556; GH Millipore Sigma 3P EZRMGH45K ...
-
bioRxiv - Physiology 2020Quote: ... inhibitor 2-bromohexadecanoic acid (2-bromo-palmitate; 2-Br) [IC50 of ∼4 µM] (Varner et al., 2003) were purchased from Sigma-Aldrich (St. Louis, MO). Bradford protein assay kit as well as anti-mouse and anti-rabbit secondary antibodies were obtained from Bio-Rad (Hercules ...
-
bioRxiv - Cell Biology 2020Quote: ... The fixed cells were then incubated with antibodies diluted in 1% BSA and 0.1% saponin at ambient temperature: 2 h with primary antibodies (anti-HDDC3, 1:25, cat# HPA040895, Sigma-Aldrich Co. ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μM carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) and 2 µM Antimicyn A / 1 µM Rotenone (all Sigma-Aldrich; Missouri, USA). The data were analyzed using Wave 2.6 Software ...
-
bioRxiv - Developmental Biology 2021Quote: Dissected brain-ring gland complexes were initially fixed in PBS with 2%PFA (cat#16005, Aldrich) and 1% glutaraldehyde (cat#G5882, Sigma) for 2 hours at room temperature followed by overnight incubation at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The female mice were sacrificed by cervical dislocation and the whole female reproductive tract with the inner contents was collected with the copulation plug at 1 hour or 2 hours after coitus and placed into 4% paraformaldehyde (PFA, Sigma) at 4°C overnight.
-
bioRxiv - Developmental Biology 2021Quote: Fish with mutations and transgenic background at 3.2 or 4 dpf were fixed 1 to 2 days at 4℃ with 4% paraformaldehyde (Sigma, P6148) in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... in a 10-cm dish transfected one day post seeding with packaging plasmids (1 μg VSV.G, 2 μg psPAX2 and 4 μg of transfer plasmid using PEI (Sigma-Aldrich). Virus containing supernatant was collected 72 hours post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... the NMDA glutamate receptor antagonist [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... All animals were incubated at 28.5 °C for 5 h before treatment with 1-phenyl-2-thiourea (PTU) (Sigma Aldrich) to prevent pigment formation ...
-
bioRxiv - Immunology 2020Quote: ... siLP cells were released by digestion of the tissue with RPMI/4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) supplemented with 60 μg/ml DNaseI (Sigma), and 400 ng/ml of Liberase (Roche Applied Science ...
-
bioRxiv - Immunology 2019Quote: ... This was followed by incubation for 1 hour at room temperature in blocking buffer consisting of 2% goat serum (Sigma) in PBS 0.1% Triton X-100 ...
-
bioRxiv - Synthetic Biology 2020Quote: Enriched M9 media was prepared using M9 salts (Difco M9 Minimal Salts) supplemented with 2 mmol L−1 magnesium sulfate (Sigma), 100 μmol L−1 calcium chloride (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol and 2 mM β-mercaptoethanol) supplemented with 1 pill of cOmpleteTM EDTA-free Protease Inhibitor cocktail (Sigma-Aldrich). Cells were then sonicated and the lysate was clarified by centrifugation in a Beckman JA-25.50 rotor at 50000 x g for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR of tetur01g11270 fragments (amplicon 1 and 2) was conducted using the Expand™ Long Range dNTPack (Sigma-Aldrich). PCR reaction mixtures were prepared according to the manufacturer’s instructions and using the following temperature profile ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... wells were washed with embryo media before the fish were incubated in media containing 0.01% 2-[4-(dimethylamino) styryl]-1-ethylpyridinium iodide (DASPEI, Sigma-Aldrich) to stain for neuromast mitochondrial activity for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... Western blotting was performed using an antibody directed towards rat kisspeptin (1:500; EMD Millipore AB9754; Billerica, MA; Table 2). This antibody has been extensively characterized (Desroziers et al. ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: pLKO.1 plasmids containing short hairpin RNA (shRNA) sequences targeting cadherin-11 or cadherin-2 were obtained from Sigma-Aldrich together with a scrambled negative control ...
-
bioRxiv - Microbiology 2019Quote: ... 500 μL of phage suspension (2 × 1010 PFU·mL-1) was mixed with 500 μL of extra pure chloroform (Merck Millipore™) and kept under 250 rpm·min-1 for 1 hour ...
-
bioRxiv - Immunology 2019Quote: ... Spleens and lymph nodes were cut into small pieces and digested in IMDM (2% FCS) containing collagenase type IA (1 mg/ml, Sigma) and DNase I (10 U/ml ...
-
bioRxiv - Microbiology 2019Quote: ... This step was repeated one more time and the pellet was resuspended in 2 mL of GAD reagent (1 g glutamic acid (Sigma), 3 mL triton X-100 (Winkler) ...
-
bioRxiv - Immunology 2019Quote: ... Embryos/larvae were kept in egg water (60 ug/ml Instant Ocean sea salts) containing 0.003% 1-phenyl-2-thiourea (PTU, SIGMA-ALDRICH) at 28.5°C and treated with 0.02% ethyl 3-aminobenzoate methanesulfonate (Tricaine ...
-
bioRxiv - Cancer Biology 2021Quote: For stable knock down of PYCR1, shPYCR1 (shPCYR1 #1: CCGGTGAGAAGAA GCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG, shPYCR1 #2: CCGGCACAGTTTCTGC TCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG) and shCTL (Sigma, Mission shRNA) lentivirus was generated in HEK293 cells ...
-
bioRxiv - Immunology 2021Quote: ... 106 cells per sample were cultured in RPMI containing 2% FBS and stimulated with PMA (50 ng ml−1, Sigma), ionomycin (2 μg ml−1 ...
-
bioRxiv - Microbiology 2021Quote: ... The bacterial pellet was re-suspended in ice-cold 100 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid) buffer (pH 8.0) containing complete protease inhibitor cocktail (Sigma, USA) and PMSF (phenylmethanesulphonyl fluoride ...
-
bioRxiv - Cell Biology 2020Quote: Imaging was performed on live animals mounted on a 2% agarose pad on glass slides with 1 mM levamisole (Sigma). For quantification of purified mitochondria and mitochondrial membrane potential ...
-
bioRxiv - Bioengineering 2020Quote: ... were added to desalted (GT)15 oligonucleotide (2 mg, Integrated DNA Technologies) in a microcentrifuge tube with NaCl solution (1 mL, 0.1 M, Sigma-Aldrich). The mixture was then ultrasonicated using a 1/8″ tapered microtip (Sonics Vibracell ...
-
bioRxiv - Bioengineering 2020Quote: ... and cells were fed with a continuous flow at 1 Psi of HS media containing 2% glucose and 0.001% Fluorescence Brighter 28 (Sigma-Aldrich). After 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... and HCT116 cells with acquired BOLD-100/KP1339 resistance were seeded as 2 × 105 cells/well in 12-well plate formate in 1 mL McCoy’s medium (Sigma Aldrich) supplemented with 2 mm glutamine and 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: Cells were grown to early log phase in synthetic complete (SC) media + 2% glycerol + 1% ethanol and gently sonicated before being loaded into a CellASIC Y04C microfluidics plate (Milipore SIGMA) under continuous media flow at 2 psi ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in normal donkey serum in PBST (2%) and transferred to rabbit anti-Fos primary antibody (1:10000; EMD Millipore) in PBST and normal donkey serum for 16 hr at RT ...
-
bioRxiv - Neuroscience 2019Quote: ... Postfixed for 2 h with 1% (w/v) osmium tetroxide (TAAB Lab) containing 0.8% (w/v) potassium hexacyanoferrate (Sigma-Aldrich) in PB ...
-
bioRxiv - Microbiology 2020Quote: Whole cell protein fractions were prepared by centrifuging 1 ml of overnight bacterial culture and resuspending the cell pellet in 2 x Laemmli sample buffer (Sigma) and boiled for 5 min at 100°C ...
-
bioRxiv - Plant Biology 2020Quote: ... Purity of the purified protein was controlled on SDS-PAGE and it was brought to a final concentration of 2 mg mL-1 using an Amicon-Ultra device (Millipore). Polyclonal antibodies against FAP were raised in rabbits (ProteoGenix ...
-
bioRxiv - Microbiology 2020Quote: ... Residual methylation reagents were neutralised by addition of 1M Tris-HCl pH 7.5 to a final concentration of 50 mM Tris-HCl and the protein complex was concentrated to 2 mg mL−1 using 30 kDa cut-off concentrators (Millipore) before injection into a S75 16/600 column (GE Healthcare ...
-
bioRxiv - Systems Biology 2021Quote: ... coli strain and cultured the cells in M9 minimal medium (Difco) supplemented with 1/2 MEM amino acids solution (SIGMA) and 0.2% (w/v ...
-
bioRxiv - Plant Biology 2021Quote: ... green tissues of 2- to 3-week old plants were sprayed until drop-off with 1 mM SA (Sigma Aldrich), 100 μM MeJA (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... then diluted to 1×107 cells/ml in liquid YPAD and incubated at 30°C for 2 hours before crosslinking with 1% formaldehyde (Sigma) for 15 minutes followed by quenching with 125 mM glycine for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... (25 mg l−1) and sodium salicylate (from 0.1 mM to 2 mM) All reagents were purchased from Sigma Aldrich, except for X-Gal ...
-
bioRxiv - Neuroscience 2020Quote: ... 66 These transgenic mice express the GEVI in cortical layer 2/3 pyramidal neurons under the intersectional control of TetO and destabilised Cre-recombinase.70–72 The destabilised Cre-recombinase was stochastically re-stabilised to induce sparse expression of the voltage indicator via two IP injections of a total of 2 × 10−4 mg kg−1 Trimethoprim (TMP, Sigma) over 2 consecutive days as described in Song et al ...
-
bioRxiv - Microbiology 2021Quote: ... in serum-free media supplemented with 0,1 μg/ml L-1-p-Tosylamino-2-phenylethyl chloromethylketone (TPCK)-treated trypsin (Sigma-Aldrich). The supernatant was harvested at 72 h post infection when cytopathic effects were observed (with around 50% cell death) ...
-
bioRxiv - Neuroscience 2019Quote: Mice were anaesthetized using Avertin (2,2,2-tribromoethanol 50 % w/v in tertiary amyl alcohol, diluted 1:40 in H2O; 20 ml/kg, i.p.; Sigma, Ireland) and placed in a stereotaxic frame (David Kopf Instruments ...
-
bioRxiv - Plant Biology 2021Quote: ... Wild-type and mutated Pik-1 and Pik-2 proteins were detected probing the membrane with anti-FLAG M2 antibody (Sigma) and anti-HA high affinity antibody 3F10 (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... with PBS +0.05% Tween20 and bound FLAG-ACE-2 was detected with HRP-conjugated anti-FLAG antibody (1:20,000, Sigma cat# A8592) and peroxidase substrate (KPL ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were irradiated using 8 J/m2 UV and labelled for 7 hours with 20 µM 5-Ethynyl-2’-deoxyuridin (EdU) and 1 µM Floxouridine (Sigma). Subsequently ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CH-5high/CH-6high subpopulation breast cancer cells (cell numbers: 0.5million) were mixed with 100μl Matrigel/cell culture media mixture (Matrigel: cell culture media = 1:2) (Sigma or Corning). Indicated cancer cells/Matrigel/ cell culture media mixtures were injected into NOD/SCID female for breast cancer xenograft (the Jackson Laboratory ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in high-salt TBS + 2% BSA + 0.1% Triton X-100 at 1:4000 (mouse anti-a-tubulin, Sigma #T6199) and 2 µg/mL (rabbit anti-CENP-A ...