Labshake search
Citations for Addgene :
1 - 50 of 770 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids encoding HA-tagged LRR (leucine-rich-repeat) domains of LRRFIP2 (Addgene plasmid # 21152), and Fli1 (Addgene plasmid # 21151) ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment containing 24xGCN4_v4 repeats was derived from Addgene plasmid #74928 ...
-
bioRxiv - Genetics 2022Quote: ... 24X MS2 repeats (Addgene #31865) were cloned into a vector containing homology arms at the first predicted high-efficiency cut site after the stop codon for the keratin-10 locus (26bp after stop ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inverted repeats were sub-cloned from Addgene plasmids #130637 ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids for the FRET-based aggregation reporter were constructed by cloning a fusion of the K18 repeat domain of tau containing the P301L/V337M mutation (20) in frame with C-terminal Clover2 (Addgene #54711) or mRuby2 (Addgene #54768 ...
-
bioRxiv - Bioengineering 2023Quote: ... crRNA expression plasmids for the Type I Eco Cascade system were generated by annealing synthetic DNA ultramers (IDT) containing direct repeats (DRs) and cloning these ultramers into the BbsI and SacI-digested SpCas9 sgRNA cloning plasmid (Addgene #47108) using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Genomics 2019Quote: ... which contained the p-Element inverted repeats (Addgene, #15308). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment with 24xMS2v7 repeats was obtained from Addgene plasmid #140705 and cloned downstream of the coding sequence ...
-
bioRxiv - Cancer Biology 2019Quote: Virus rich media (VRM) of the Cas9-Blast plasmid (Addgene: #52962) was infected into regular AML lines using the standard lentivirus infection protocol described below ...
-
bioRxiv - Biochemistry 2024Quote: ... or 74 CAG repeats (GFP-Q74: mutant HTT. Addgene, #40262). Vectors to alpha synuclein were a gift from our collaborator Dr ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST V and inverted repeat constructs were sub-cloned from Addgene plasmids #127922 and #127924 to generate pIF1005 ...
-
bioRxiv - Neuroscience 2020Quote: ... a transfer plasmid containing rat Synapsin promoter and cDNA encoding GCaMP6s (Addgene plasmid #40753) was assembled and transfected with helper-free DJ plasmids (Cell Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and the DAG maker C1δ-GFP amplified from rat PKCδ C1-containing plasmid (Addgene #21216) 61 was expressed from ura4 locus under scs2 promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by a GCN4 leucine zipper for dimerization (adapted from Addgene #61665; (Norris et al., 2014)) ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... TALEN repeat variable di-residues (RVDs) were cloned into an RCIscript-GoldyTALEN vector (Addgene) and capped mRNAs for each TALENs were in vitro transcribed from SacI-linearized expression plasmids using mMESSAGE mMACHINE T3 kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into BsmBI digested plasmid that encodes RfxCas13d direct repeat (Addgene #138150). PspCas13b crRNA spacers were designed as 34-nt single-stranded forward and reverse oligos containing CACC and CAAC overhangs ...
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into Bbsl-digested plasmid that encodes PspCas13b direct repeat (Addgene #103854). Oligos were ordered as single stranded DNA (IDT ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Biochemistry 2020Quote: The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) system with pX330 vector (Addgene) was used to edit the CDC50A gene in HEK293S GnT1-cells as described 4 ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Cancer Biology 2019Quote: ... in the leucine zipper region of the bZIP domain by site-directed mutagenesis of the pBabe mRFP1-NRF2 hygro plasmid (Addgene #136579) originally prepared by subcloning into pBabe mRFP1 hygro ...
-
bioRxiv - Cell Biology 2023Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Developmental Biology 2021Quote: ... we cloned the DNA encoding the TALE repeats and flanking regions into JDS74 (plasmid #32288) and JDS71 (plasmid #32287) vectors (Addgene). The vector OCT4-2A-eGFP-PKG-Puro (plasmid #31938 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pXR003 processed gRNA was cloned into pKLV2.3-Hygro mCherry gRNA lentiviral plasmid (33) using EcoRI and Mlu and amplying (d)CasRx directed repeats from pXR003 processed gRNA (Addgene #109053) using the following F (CCCACGCGTGAGGGCCTATTTCCCATGATTC ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing 1.6 kb telomeric TTAGGG repeats with a 23-bp interruption linking two (TTAGGG) 135 regions (T270, 5.4 kb) was purchased from Addgene (plasmid pSXneo(T2AG3), #12403 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids containing sgRNAs (Addgene 41824) and a human codon-optimized Cas9 (Addgene 41815 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids containing EYA2 (Addgene #49264), RUNX1T1 (Addgene #49264) ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-mCherry (Addgene) at a titer of 1.4-2.8×1013 GC/mL.
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...