Labshake search
Citations for Addgene :
301 - 350 of 770 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids containing the coding sequences of human SLC46A1 (pDONR221_SLC46A1) and SLC46A3 (pDONR221_SLC46A3) were purchased from Addgene. Custom plasmids (pTwist-CMV ...
-
bioRxiv - Physiology 2022Quote: The pcDNA3.1 plasmid containing the PinkFlamindo coding sequence (PinkFlamindo-pcDNA3.1; (59) was obtained from Addgene (#102356). The following primers were used for PCR amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Immunology 2019Quote: Hem1 expression constructs containing C-terminal 3xFLAG-v5 tags were generated in a pcDNA3.1 backbone (Addgene) using Gateway cloning technology (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Blasticidin-resistant cells were subsequently transduced with viral supernatant containing LentiGuide-Puro plasmid (Addgene plasmid #52963) with ligated selected sgRNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... A plasmid containing estrogen receptor alpha (pEGFP-C1-ERα) was obtained from Michael Mancini (Addgene #28230) and mutated into a constitutively active form (pEGFP-C1-ERαY537S)29 using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into plasmid DNA containing the Cas9 enzyme and a puromycin resistance cassette (PX459, Addgene) followed by exonuclease treatment ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmids containing the dCas9-effector fusions were derived from the dCas9-KRAB vector backbone (Addgene #110820) and modified by Gibson Assembly with their respective effectors from sources listed above ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled in a Golden Gate assembly containing 6.25 ng pU6-atgRNA-GG-acceptor (Addgene #132777), purified PCR product (approximately 2-to-4-fold molar excess) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lentiviral control vector containing a scrambled shRNA (shSCR) was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Cancer Biology 2021Quote: Neonatal human dermal fibroblasts (HDFns) were transduced with lentiviruses containing pCHAC-mt-mKeima (Addgene plasmid #72342) (Lazarou et al. ...
-
bioRxiv - Cancer Biology 2021Quote: The oligos containing the gene-specific sgRNA target were cloned into the LentiCRISPRv2 Blasticidin (Addgene, 83480) as previously described 53 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-cGAS was inserted into an HA-containing vector (gift from Qing Zhong; Addgene plasmid #280274) (53 ...
-
bioRxiv - Physiology 2022Quote: ... a DNA block containing sgEGFP-tRNA-Hnf4a-sg2 was PCR-amplified using pGTR plasmid (Addgene #63143) as a template and primers listed in Table S2 (see also Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... A plasmid containing the full-length human FOS cDNA (NM_005252.4) was purchased from Addgene (Plasmid #59140). The full-length FOS cDNA was cloned into the pCS2 vector and FOS mRNA was generated using the mMessage mMachine Sp6 kit (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligos containing the gene-specific sgRNA target were cloned into the LentiCRISPRv2 Blasticidin (Addgene, #83480). The CRISPR/Cas9 primer sequences were as followed:
-
bioRxiv - Cancer Biology 2023Quote: For HDTVI the following plasmids were used: pCMV(CAT)T7-SB100 containing SB100X transposase (Addgene #34879). For Myr-AKT and YAP5SA expression the pSBbi-Puro vector from Addgene (#60523 ...
-
bioRxiv - Molecular Biology 2022Quote: Oligonucleotides containing gRNA sequence were Annealed and later cloned into lentiGuide-puro plasmid (Addgene Cat # 52963) followed by the published protocol 39 ...
-
bioRxiv - Microbiology 2023Quote: The eSpCas9(1.1) gene containing two nuclear localization signals (NLS) was obtained from Addgene (Plasmid #71814) and cloned into the pST32 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... a solution containing either AAV9.hSyn.eGFP.WPRE.bGH or AAV9.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #50465-AAV9 or #105540-AAV9) was pipetted onto the hippocampus within the slice (1 μL on each hemisphere ...
-
bioRxiv - Bioengineering 2023Quote: A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #1000000061). Expression vectors for yeGFP ...
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments containing MAP3K1 (MEKK1) or kinase-dead MAP3K1 were excised from pCDNA-MEKK1 plasmids (Addgene #12181 and #12180 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids containing the AXL phosphosite mutations were generated from an AXL-IRES-Puro vector (Addgene #65627) using site directed mutagenesis ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids containing the relevant guides were co-transfected with helper plasmids psPAX2 (Addgene Ref. 12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... each well was transfected with 1.5 µg of the plasmid containing the YFP-Parking gene (Addgene, 23955 ...
-
bioRxiv - Molecular Biology 2019Quote: ... A lentivirus construct containing the biotin ligase BirA was generated from the lentiCRISPR v2 backbone (Addgene 52961)[61] and a construct containing BirA (a gift from Mauro Modesti ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing GA50 was amplified from pAG303-Gal-GA50 (Addgene # 84907; (Jovičič et al., 2015)) and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Immunology 2019Quote: ... GXMR-CAR containing the lentiviral vectors pMD2.G (VSV-G envelope-expressing plasmid; Addgene; cat. no. 12259) and psPAX2 (second-generation lentiviral packaging plasmid ...
-
bioRxiv - Microbiology 2019Quote: Oligos containing sgRNA sequence were annealed and ligated into pX458 (gift from Feng Zhang; Addgene plasmid # 48138). Cells were transfected with pX458 using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and to a plasmid containing the Oct4:EGFP transgene (GOF18ΔPE EGFP, Addgene plasmid #52382; http://n2t.net/addgene:52382; RRID:Addgene_52382).
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Bioengineering 2019Quote: GV-expressing cells were produced by transforming a pET28a plasmid containing the arg1 gene cluster12 (Addgene #106473) into BL21(A1 ...
-
bioRxiv - Neuroscience 2021Quote: ... The GFP coding region containing artificial introns was PCR-amplified from the vector pPD95.69 (Addgene plasmid #1491) using primers to add segments encoding SGGGGS and SGGGTS to flank the N- and C-termini of GFP ...
-
bioRxiv - Biochemistry 2020Quote: ... and Gibson-assembled into a pHR vector containing a C-terminal mCherry-CAAX fusion tag (Addgene #50839). Stellar E ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Cancer Biology 2020Quote: The vector containing RON (MST1R) pDONR223-MST1R was a gift from William Hahn and David Root (Addgene plasmid # 23942 ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Genetics 2021Quote: ... Constructs containing different sgRNAs (500 ng) were co-transfected with pCMV-ABE7.10 (2000 ng, Addgene plasmid # 102919) into cells by using LipofectamineTM 3000 (Thermo Fishers ...
-
bioRxiv - Neuroscience 2021Quote: ... we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or vector containing the dominant negative TP53 construct (pBABE-hygro p53 DD, Bob Weinberg, Addgene plasmid #9058) into the clonal MCF10-2A TetOn-CENPA-FLAG-HA cell line by lentiviral transduction ...
-
bioRxiv - Genomics 2021Quote: ... Early passage primary MEFs were transformed with SV-40 T antigen containing plasmid pBSSVD2005 (ADDGENE, Cambridge, MA) to generate immortalized MEFs ...
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...