Labshake search
Citations for Addgene :
401 - 450 of 770 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Mice were injected using a glass pipet containing AAV1-CaMKIIa-hChR2(H134R)-eYFP (Lee et al., 2010) (Addgene) and the dye fast green (total volume ∼0.5 μl/injection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfecting the PIKFYVE-containing plasmid with the packaging plasmids pMD2.G and psPAX2 (Addgene 12259 and 12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046), 10 μg of pX330-p53 (Addgene 59910) ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Synthetic Biology 2020Quote: ... donor vectors containing Tom20-CR driven by the CAG promoter were constructed using pAAVS1-P-CAG-mCh (Addgene, #80492). The pAAVS1-P-CAG-mCh vector was inversely amplified using primers that excluded the mCherry sequence flanked by the EcoRI site (termed pAAVS1-P-CAG-Tom20-CR) ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Cell Biology 2021Quote: The anillin AHD + PH domain containing pEGFP-RhoA Biosensor plasmid was a gift from Michael Glotzer (Addgene plasmid # 68026). The EGFP was replaced with mTurquoise2 by making use of the AgeI and BsrGI restriction sites.
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette tip of 20–30 μm containing CTB647 (ThermoFischer Scientific, C34778) or AAV (Addgene, AAV-PHP.eB) was lowered into the brain ...
-
bioRxiv - Neuroscience 2022Quote: ... We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG) and cloned it into the Cas9-containing plasmid pSpCas9(BB)-2A-GFP (Addgene) as described (Ran et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Neuroscience 2021Quote: ... a glass pipette (0.1-0.2 mm diameter at the tip) containing the pAAV-Syn-Chronos-GFP (Addgene #59170-AAV1) or AAV1-hSyn-Cre (Addgene #105553-AAV1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Neuroscience 2021Quote: ... Adeno-associated virus containing the GCaMP7f gene (pGP-AAV9-syn-FLEX-jGCaMP7f-WPRE, 104488-AAV9, Addgene, Watertown, MA, USA) was loaded into a glass micropipette with a tip diameter of 40–50 µm attached to a Nanoject II injection system (Drummond Scientific ...
-
bioRxiv - Genetics 2021Quote: ... PT5/Cas9 cells were transfected with an equal-parts mixture of pLib6.4 containing an sgRNA library as well as pBS130 (26290, Addgene) using Effetene (301427 ...
-
bioRxiv - Microbiology 2021Quote: CRISPR plasmid constructs containing mosaic gRNAs were cloned by T4 ligase oligonucleotide insertion (Table S5) in px333 (Addgene #64073) or pLentiCRISPR-RFP657 (Addgene #75162 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the adherent cell cultures were cultured in the presence of lentiviral particles containing ΔLTR flanked CMV:tdTomato-blasticidin (Addgene#106173) and 8µg/mL polybrene (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Cancer Biology 2023Quote: PB-UniSAM containing mCherry was a gift from Lesley Forrester (Addgene plasmid # 99866; http://n2t.net/addgene:99866; RRID: Addgene_99866) (Fidanza et al ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid containing chTOG cDNA was a gift from Stephen Royle (Addgene plasmid # 69108; http://n2t.net/addgene:69108; RRID: Addgene_69108). The chTOG cDNA was subcloned into a modified pFastBac vector containing an N-terminal 6xHis tag (a gift from G ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Next day the transfection master mix which contained 10µg of CRISPR construct containing sgRNA targeting the gene of interest (or empty lentiCRISPRv1-puro, #49535, Addgene), 7.5µg of pSPAX2 (#12260 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass pipette (tip diameter: ∼100 µm) containing the retrograde AAV-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene #51085) was slowly lowered into the IC at a rate of 1 µm/s using a micromanipulator (Sutter MP-285) ...
-
bioRxiv - Molecular Biology 2023Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Cell Biology 2023Quote: ... which were co-transfected with the gRNA containing lentiCRISPRv2 vector together with the packaging vectors pMDLg/pRRE (Addgene; 12251), pRSV-Rev (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... GOI_gRNA2_F and GOI_gRNA2_R) containing gRNA sequence were annealed and cloned into BsaI site of the pU6-Universal vector (Addgene #52694). To generate a construct for deleting the entire coding region of GOI ...
-
Somatostatin interneurons control the timing of developmental desynchronization in cortical networksbioRxiv - Neuroscience 2023Quote: Pups were injected at birth (P0) with a viral cocktail containing pAAV1-syn-GcaMP6s-WPRE-SV40 (Addgene, 100843-AAV1) and pAAV1-syn-GcaMP6s-Flex WPRE-SV40 (Addgene ...
-
bioRxiv - Genomics 2024Quote: ... were combined with CROPseq-Puro-F+E plasmid (containing the sgRNAs) or dCas9-mCherry-ZIM3-KRAB plasmid (Addgene 154473) and transfected using Lipofectamine™ 3000 (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was produced in HEK293T cells that were co-transfected with the vector containing the gene of interest and second generation envelope and packaging plasmids (psPAX–gift from Didier Trono (Addgene plasmid#12260 ...