Labshake search
Citations for Addgene :
401 - 450 of 648 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and mice were injected with either the AAV5-DIO-hTyr experimental virus or a comparable AAV5-DIO-EYFP control virus (Addgene, plasmid #27056). Due to the volume of virus required for these experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... a control cassette was first created by replacing the BspEI/KpnI segment of the pmGFP-P2A-K0-P2A-RFP (Addgene plasmids 105686) with a linker containing a P2A site ...
-
bioRxiv - Neuroscience 2022Quote: ... JEDI-1P was cloned into pAAV vector under the control of the neuron-specific hSyn promoter by replacing the ASAP2s sequence in pAAV-hSyn-ASAP2s (Addgene plasmid #101276). pAAV-hSyn vector was linearized with restriction enzymes KpnI and HindIII.
-
bioRxiv - Immunology 2022Quote: Single-guide RNAs targeting screen hits and non-targeting control sgRNAs were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid # 52961), with an additional G added in the beginning of the sgRNA sequence (Table S3P) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The capsids were then used to package a single-stranded rAAV vector expressing firefly luciferase under control of the CAG promoter (pAAV-CAG-FLuc, Addgene, catalog 83281). rAAVs were purified using AAVpro® Purification Kit for All Serotypes (Cat # 6666 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA sequences targeting KSR1 or non-targeting control were inserted into pCAG-SpCas9-GFP-U6-gRNA (Addgene #79144, gift of Jizhong Zou). PEI transfection was used to insert pCAG-SpCas9-GFP-U6-sgKSR1 or non-targeting control into H460 and HCT116 cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids used for tdTomato-Tau overexpression and the tdTomato-C1 control plasmid were a gift from Michael Davidson: tdTomato-MAPTau-C-10 (Addgene plasmid #58112), tdTomato-MAPTau-N-10 (Addgene plasmid #58113 ...
-
bioRxiv - Molecular Biology 2023Quote: The AAV encoding for SpCas9 under the control of the CMV promoter (pX551-CMV-SpCas9) was a gift from Alex Hewitt (Addgene plasmid # 107024). For the AAV encoding for sgRNA and GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... we employed a PiggyBac plasmid expressing cDNA insert adba transposase vector of choice under the control of a doxycycline-inducible promotor (a kind gift from Volker Busskamp, Addgene plasmid #104454). The donor vector carries M2Rtta and a site for cDNA insert of transcription factor of interest ...
-
bioRxiv - Immunology 2023Quote: ... was co-transfected with a plasmid expressing the luciferase gene (Luc) under the control of the minimal promoter of the Il17a gene (minIL17prom-Luc) (Addgene, No. 20124). Transfections were performed using calcium phosphate method ...
-
bioRxiv - Neuroscience 2024Quote: ... or the double floxed control vector carrying a cDNA for mCherry alone (pAAV5-hSyn-DIO-mCherry, abbreviated here as Ctrl or control vector, #50459-AAV5, Addgene, Watertown, MA), using 0.3 μL of virus per site at a titer of > 1–2 x 10¹3 vg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.85 μl of virus coding for either muscarinic-receptor-based DREADD AAV8-hSyn-hM4Di(Gi)-mCherry or control virus AAV8-hSyn-EYFP (AddGene, Cambridge, MA) was injected bilaterally into either the mPFC (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... For anterograde tracing of PV or SST neurons of the audTRN and control experiments we injected 250nL or 400nL of AAV5-hSyn-DIO-mCherry (full titer, Addgene 50459-AAV5).
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293T cells were transfected with above lentiCRISPR SHMT2 plasmid or control V2 plasmid together with helper plasmids pPAX2 and UVSVG (Addgene #8454 and #12260) using Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... vector expressing a constitutively active form of AMPKa (AMPKα21-312) and GFP (Green Fluorescent Protein) or a control AAV vector (Addgene: plasmid # 60127 and # 50465) were injected bilaterally in the BLA at P35 ...
-
bioRxiv - Neuroscience 2021Quote: ... and four mice (control group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-WPRE-eYFP (Addgene viral prep 27056-AAV5) at a rate of 75 nl per min using surgical procedures (anesthesia ...
-
bioRxiv - Developmental Biology 2021Quote: The Lgr6 overexpression plasmid (pCAG-Lgr6) was constructed by replacing the GFP cassette in the control vector (pCAG-GFP; plasmid #11150, Addgene, Cambridge, MA, USA) with the mouse Lgr6 coding sequence ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: Vectors coding the dCas9-DNMT3ACD-DNMT3LCD-3xFLAG fusion gene (contains the enzymatic group of the DNA methyltransferase DNMT3) and the control plasmid pCMV-dCas9-mD3A (#78257, Addgene, Watertown, MA, USA) were used as described in 14,22 ...
-
bioRxiv - Cancer Biology 2023Quote: The Human Brunello v2 CRISPR KO pooled library (76,441 gRNAs, targeting 19,114 genes, including 1,000 controls) was bought from Addgene (Watertown, MA, USA, Addgene ID: 73179). Plasmid library were amplified by electro-transformation (Lucigen ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Biophysics 2020Quote: ... We have also deposited BbZIP gene in pETNb-cALFA and hP2X3 gene in pBMNb-cALFA as positive controls for FSEC-Nb (Addgene IDs 160498 and 160499).
-
bioRxiv - Molecular Biology 2022Quote: ... baculovirus gp64 signal sequence under control of the very late polyhedrin promoter was inserted into the insect cell vector plasmid pACEBac1 (Addgene, LGC Standards Teddington, UK) by using another synthetic gene (VK18 ...
-
bioRxiv - Genetics 2019Quote: ... 2016) by using lentiviral constructs pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W and pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W as a control (Addgene 67980 and 67979 respectively). 5×10^5 Cas9 expressing single cells were infected with either lentiviral supernatant in 6-well plate with 2ml TeSR-E8 in the presence of 10uM Rock inhibitor ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...