Labshake search
Citations for Addgene :
301 - 350 of 593 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... A repair template encoding TIR1 under the control of the alpha tubulin promoter (pTUB1) and a CAT expression cassette was amplified from Addgene plasmid #87258 using oligos P1/P2 ...
-
bioRxiv - Genetics 2022Quote: Male adult Smg6flox/flox mice and their control littermates (Smg6+/+) received bilateral stereotactic injections of CMV.HI-Cre::eGFP AAV5 particles (AddGene, 105545) into the SCN (400 nl per site) ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... SNCA KD and control plasmids (Zharikov et al., 2015), and Mito-PAGFP plasmid (Karbowski et al., 2004) were purchased from Addgene (plasmids 85131 ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Microbiology 2023Quote: ... ANP32B or a non-targeting control gRNA as well as with the packaging plasmids pMD2.G and psPAX2 (gifts from Didier Trono, Addgene plasmids # 12259 and # 12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting XRN1 sg1 and sg2-resistant XRN1 constructs and a GFP control construct were sub-cloned into the pLEX307 lentiviral expression vector (Addgene) under the control of an EF-1α promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received bilateral infusion an AAV encoding the inhibitory opsin Arch (AAVDJ-Syn-eArch-eYFP, Stanford Vector Core) or fluorophore control (AAV8-Syn-GFP; Addgene) into the CeA (0.1-0.2 µl) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The UNK-targeting or non-targeting control guide sequences were introduced into the BsmBI-digested lentiCRISPR v2-Blast plasmid (Addgene_83480) as pairs of annealed oligos62.
-
bioRxiv - Neuroscience 2023Quote: ... mice received bilateral infusion of an AAV encoding the inhibitory opsin archaerhodopsin (AAVDJ-Syn-eArch-eYFP, Stanford Vector Core) or fluorophore control (AAV8-Syn-GFP; Addgene) into the BLA (0.1 - 0.2 µl) ...
-
bioRxiv - Neuroscience 2023Quote: ... of adeno-associated viruses encoding the genetically-encoded calcium indicator GCaMP6s and mRuby2 as a structural marker under the control of the synapsin 1 promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, cat. no. 50942-AAV1, Addgene) and slowly lowered to ∼350 µm below the surface of the exposed brain with an HO-10 hydraulic micromanipulator (Narishige) ...
-
bioRxiv - Genomics 2023Quote: ... pmCherry was a 4.7kb plasmid that expressed mCherry fluorescent protein under the control of a CMV promoter (Addgene, Cat# 632524). L1 plasmids consisted of pUBC-L1SM-UBC-EGFP and pMut2-UBC-L1SM-UBC-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Neuroscience 2023Quote: The control vector expressing eYFP in the Cre-dependent and Flp-dependent manner was a gift from Karl Deisseroth (Addgene plasmid # 55650 ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Plant Biology 2019Quote: ... containing a human codon optimized allele of Cas9 under the control of the AtRPS5a promoter and the Pisum sativum rbcS E9 terminator (Addgene: 117505) was assembled with a FAST-Red selectable marker (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Casper strains were available and 20 ng/μL DNA plasmids encoding mNG-GECO1 under the control of nuclear-localized elavl3/HuC promoter (Addgene: 59530) were injected into two-cell stage embryos of Casper mutant zebrafish33 with 40 ng/μl Tol2 transposase mRNA (26 ...
-
bioRxiv - Genetics 2019Quote: ... A single stranded rAAV vector expressing Firefly luciferase (FLuc) under control of the CAG promoter (pAAV-CAG-FLuc, Addgene, Cat#83281) was generated by replacing the GFP sequences in plasmid pAAV-CAG-GFP with Firefly luciferase sequences obtained from plasmid pAAV-EF1α-FLuc-WPRE-HGHpA (Addgene ...
-
bioRxiv - Microbiology 2019Quote: Single oligonucleotide guides for three scramble controls and two exons in Tax1bp1 selected from the Brie library were closed into lentiGuide puro (Addgene #52963) using the following primer pairs ...
-
bioRxiv - Cancer Biology 2021Quote: The control and LKB1-KO lines were generated by infecting the cell lines with lentivirus generated from the LentiCRISPRv2 plasmid (Addgene: 52961). The control and TPI1-KO or SIK-KO lines were generated by infecting the Cas9-expressing lines (LentiCRISPRv2 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Genomics 2022Quote: AAV coding STAT5bCA and Luciferase (control) was prepared and quantified by triple transfection of HEK293FT cells using methods adapted from protocols provided by Addgene (www.addgene.org). HEK293FT is a fast growing and highly transfectable derivative (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRen targeting Renilla luciferase cDNA was used as negative-control sgRNA (GGTATAATACACCGCGCTAC)33 and cloned into lenti sgRNA(MS2)-zeo backbone (Addgene: 61427) or lenti sgRNA(MS2)-zeo-IRES-eGFP backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA), All animals received three viral injections in the anterior cingulate cortex in each hemisphere as follows (skull at +5.0mm to horizontal plane) ...
-
bioRxiv - Neuroscience 2020Quote: ... and the control group (n = 10) received injections of AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA). The injection coordinates and volumes for the three injections made into the anterior cingulate cortex were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2020Quote: ... Nfia/bxlox/lox;Sun1-sGFP and GLASTCreERT2;Sun1-sGFP control mice were intravitreally injected with 1 μl of AAV9-pCAG-Flex-Tdtomato (Addgene #28306) at 1×10¹³ vg/mL and treated with Tamoxifen diet for 3 weeks ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Immunology 2021Quote: ... LentiGuide-Puro empty vector (control) or SP140 gRNA cloned plasmids were then co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... Additional viral constructs were assembled for Cre-dependent expression of a reporter under the control of the Dlx5/6 enhancer: AAV-Dlx-Flex-GFP (Addgene #83900) and AAV-Dlx-Flex-ChR2-mCherry (Dimidschstein et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... An AAV that only expressed the mCherry protein under the same neuronal promoter was use as control condition (Addgene Plasmid #114472). Wildtype and Cdr1as-KO neurons were infected at DIV4-6 by directly adding the viral particles into the culturing media at a titer of 109 VG/ml ...
-
bioRxiv - Microbiology 2022Quote: ... 2015) or in a strain expressing Cas9 from the X1 locus under control of the vasa promoter (transgenesis plasmid: Addgene # 173670) and introgressed into the Ngousso genetic background ...
-
bioRxiv - Neuroscience 2023Quote: ... NPC-derived NGN2-neurons (mid SCZ PRS control donors of European ancestry 2607 (XY) and 553 (XY)) were transduced with the mixed-pooled gRNA vectors (Addgene 99374) at day 17 ...
-
bioRxiv - Genetics 2022Quote: ... Non-target PLKO.1 shRNA viral particles were also made with the same system using the TRC non-target control lentiviral vector (Addgene # 10879). HEL and TF-1 cells were infected with EGR1 shRNA and non-target shRNA viral particles using spinfection and infected cells were selected with puromycin (2 μg/mL for TF-1 and 4 μg/mL for HEL) ...
-
bioRxiv - Cancer Biology 2022Quote: sgRNAs (oligonucleotide sequences are indicated in Table S6) targeting IDO1 as well as non-targeting control were cloned into lentiCRISPRv2 puro plasmid (Addgene, #98290). Lentiviral packaging vectors psPAX2 (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... expressing the firefly coding sequence under control of a synthetic promoter containing SMAD-binding elements (SBEs) was obtained from AddGene (#45126). pEFBOS mCherry-mSTING expressing monomeric Cherry fused to the N-terminus of murine STING ...
-
bioRxiv - Genomics 2023Quote: ... The all-in-one HER2 CAR constructs used for in vivo tumor control studies were cloned by digesting an empty lentiviral vector for constitutive gene expression (Addgene 79121) with MluI and amplifying the HER2-CAR70 and 2A-GFP or 2A-BATF3 (gblock ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470; inhibition: AAV1-CAG-tdTomato, Addgene #59462). Viral injection volume was scaled by age with 200nL injected at P9 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Lentiviral particles for CEBPB knockdown were generated by transfecting shRNA plasmids (TRCN0000007440 and TRCN0000007442) or scramble shRNA control (a gift from David Sabatini; Addgene_1864 [50]), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Neuroscience 2023Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290)60) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed dsDNA was sub-cloned into the BsmbI-digested lentiviral sgRNA-EFS-GFP/mCherry vector under the control of U6 promoter (LRG, Addgene #65656). To improve the transcription efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...