Labshake search
Citations for Addgene :
151 - 200 of 593 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and viral supernatant for guides targeting SETD2 or non-targeting control sgRNA (Addgene, 80189). Cells were selected using 0.5μg/mL puromycin (Millipore Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... or a control virus AAV9-hSyn-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) was injected in the NAcSh of WT mice while AAV9-Syn-Flex-GcAMP6f-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...
-
bioRxiv - Neuroscience 2022Quote: AAV9 expressing GFP-Cre under the control of CamKII promoter (pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40, Addgene #105551) was used to delete the expression of PRs in the EC of adult PRCE males ...
-
bioRxiv - Neuroscience 2022Quote: ... Control groups were injected with pAAV-hSyn-mCherry (a gift from Karl Deisseroth; Addgene viral prep # 114472-AAV5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 non-targeting control sgRNAs were randomly picked from the Brie library59 (Addgene #73633). All 500 sgRNA sequences are listed in Supplementary Information Table 1.
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... BTN3A1 or control BTNL3 in pMIG (a gift from D. Vignali (Addgene plasmid # 52107) 31 using ViaFect® (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA sequences targeting KSR1 or non-targeting control were inserted into pLentiCRISPRv2GFP (Addgene #82416). The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TERRA and non-template control (NTC) gRNAs were cloned in pLentiRNAGuide_002 (138151, Addgene). Sequences of guide RNAs are provided in Supplementary Table S1 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pLKO.1-Neo-CMV-tGFP-Scramble shRNA plasmid (Addgene#136035 as scramble control). Lentiviral vectors were packaged using packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene Plasmid #17920).
-
bioRxiv - Neuroscience 2019Quote: ... (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter, Addgene #26290)70 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9 empty vector as control) and AAV1.Tdtomato (5.0E+12 viral genomes /mL; Addgene, 59462) were added to 1 mL culture medium.
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals were injected with a cre-dependent YFP as a control (AAV5.Ef1a.DIO.EYFP; Addgene). A 5 mm optic fiber (Ø200 µm Core ...
-
bioRxiv - Cancer Biology 2021Quote: ... The control plasmid sgCtr-LentiCRISPRv2 expressing a non-target sgRNA was purchased from Addgene (#107402) (56) ...
-
bioRxiv - Neuroscience 2022Quote: ... or pAAV-hSyn-DIO-mCherry (Control mCherry reporter; Addgene #50459, titers: 7×1012 vg/ml) into the VTA ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Cancer Biology 2019Quote: eGFP as control or RB1 were cloned into the Rc/CMV vector (Addgene plasmid 1763). Electroporesis-based transfection protocol (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used STAT3C lentiviral plasmid and control GFP plasmid purchased from Addgene (Supplemental Table S2). STAT3C carries a mutation that constitutively activates STAT3 ...
-
bioRxiv - Cancer Biology 2023Quote: ShRNAs against Cx31 and GFP control were constructed using Tet-pLKO-Puro (Addgene plasmid #21915). shRNAs used were as follows:
-
bioRxiv - Molecular Biology 2022Quote: ... GSK3β and non-targeting control gRNAs were a gift from John Doench & David Root (Addgene plasmids #77281 ...
-
bioRxiv - Systems Biology 2023Quote: ... pcDNA3.1 mCit-His3C-GW as well as controls pcDNA3.1-NL-cmyc (Addgene plasmid ID #113442), pcDNA3.1-PA-mCit (Addgene plasmid ID #113443 ...
-
bioRxiv - Neuroscience 2023Quote: ... we delivered GCaMP6f under control of the synapsin promoter (AAV1/9-SYN-GCaMP6f; Addgene, #100837)51 ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA encoding SNAPf or H2B-SNAPf was amplified from pSNAPf-H2B control plasmid (Addgene #101124) to generate an insert ...
-
bioRxiv - Microbiology 2023Quote: ... or empty pCDNA3.1 as control (12.5 μg) were injected together with pSBbi-RN (Addgene #60519) integrating reporter plasmid encoding dTomato (12.5 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... Non-targeting control sgRNA and Cdk12-sgRNAs were cloned into lentiCRISPR v2 plasmid (Addgene 98290). Myc-CaP cells were transiently transfected with control sgNT or pair of two independent Cdk12-targeting sgRNAs ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Some later control experiments described in the Supplementary data used AAVs sourced from Addgene (USA). While retrograde expression of AAV1 has been described previously (Zingg et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... A Cre-dependent GCaMP6f under the control of the synapsin promoter (pAAV.Syn.Flex.GCaMP6f.WPRE.SV40, 100833-AAV9 from Addgene) was used for delivery of the construct ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Cell Biology 2024Quote: ... and non-targeting control (GCGAGGTATTCGGCTCCGCG) were annealed and cloned into lenti-sgRNA Blast (Addgene #104993). E0771 cells lines stably expressing a doxycycline-inducible MRTF-A construct were generated as previously described by sequential transduction with rTTA ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2022Quote: The following two Piezo sgRNAs and a control sgRNA were cloned into the lentiCRISPRv2 vector (Addgene) containing Cas9 ...
-
bioRxiv - Systems Biology 2022Quote: ... pSNAPf-Cox8A Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101129). The primers used for cloning were synthesized by BioTeZ Berlin-Buch GmbH and are listed in Table S3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lentiviral control vector containing a scrambled shRNA (shSCR) was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Neuroscience 2022Quote: ... Control mice were injected with AAV9 expressing GFP under the control of CamKII promoter (pENN.AAV.CamKII0.4.eGFP.WPRE.rBG, Addgene # 105541). The injections were performed bilaterally (Adotevi et al. ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Cancer Biology 2022Quote: MMS22L-KO and AAVS1 control cells were infected with lentiviruses generated using LV-GFP (Addgene #25999) or LV-RFP (Addgene #26001 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... TG+ controls received identical bilateral infusions of AAV5-hSyn-DIO-mCherry (7×1012 vg / mL; Addgene) and TG-controls received sterile saline.
-
bioRxiv - Cancer Biology 2023Quote: ... The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene, cat# 1764) and pBABEpuro-ERBB2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bacterial clones expressing double-stranded RNA (dsRNA) included the control (empty vector pL4440) sourced from Addgene, Cambridge ...
-
bioRxiv - Cancer Biology 2024Quote: ... and non-targeting control sgRNAs (GTTCCGCGTTACATAACTTA; CTCTGGCTAACGGTACGCGTA) were cloned into lentiCRISPRv2 vector from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a control plasmid pBABE-puro (Gift from Hartmut Land, Jay Morgenstern and Bob Weinberg (RRID:Addgene_1764)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... B16F10 pC and PANO2 pC were stably transfected with control (empty) overexpression vector eGFP.retro.puro (Addgene ID 64336, RRID:Addgene_64336) (3) ...