Labshake search
Citations for Addgene :
551 - 600 of 648 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: The mouse Brie CRISPR knockout pooled library (lentiCRISPRv2 backbone; a gift from David Root and John Doench (Addgene #73633) was sub-cloned into the pMX-28 retroviral vector (Fig ...
-
bioRxiv - Pathology 2022Quote: ... tdTomato-WPRE-polyA sequence was obtained from the sequence of the targeting vector for Ai9 mouse (Addgene plasmid #22799) since the Ai9 mouse shares the same sequence for tdTomato-WPRE-polyA with the Ai14 mouse used in this study29 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865; http://n2t.net/addgene:108865; RRID:Addgene_108865).
-
bioRxiv - Molecular Biology 2023Quote: ... The AMPKγ1 mutant vector wherein Ser260 and Thr262 were replaced with alanine was created using parent-template backbone mouse AMPKγ1- full-length vector (# 15996, Addgene) and primers with the desired mutation ...
-
bioRxiv - Molecular Biology 2024Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Developmental Biology 2024Quote: ... a clone of EUC313f02 NipblFLEX/+ ES cells (European Conditional Mouse Mutagenesis Program) was transfected with pCAG-Cre:GFP (Addgene #13776) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid MyosinIIA-GFP [23] that encodes for mouse GFP-Myosin9 was a gift from Matthew Krummel (Addgene plasmid #38297).
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... The gene encoding mouse E1 was a kind gift from Jorge Eduardo Azevedo (Addgene plasmid 32534, (Carvalho et al., 2011)) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Immunology 2022Quote: ... SpCas9-expressing Nrp1-/- NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of mouse ARNTL was synthesized (Twist Biosciences) and cloned into the NheI site of FUW-TetO-MCS (Addgene plasmid #84008 ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... heterozygous Adora2a-Cre mouse neonates were injected bilaterally with the Cre-recombinase-dependent viral vectors AAV5-hSyn- DIO-hM4D-mCherry virus (Addgene Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... The oligodendrocyte-specific mouse-derived MBP promoter was amplified from the pAAV-MBP-2xNLS-tdTomato gift from Viviana Gradinaru (Addgene plasmid # 104054 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine, Addgene plasmid #127899 ;http://n2t.net/addgene:127899 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900 ...
-
bioRxiv - Cancer Biology 2021Quote: We generated pX330 Mettl3 vector by cloning the previously described sgRNA targeting mouse Mettl316 into the pX330 plasmid (Addgene Plasmid #42230). The pX330 plasmid was digested using BbsI and a pair of partially complementary annealed oligos containing overhangs from BbsI site and Mettl3 sgRNA sequence were cloned scarlessly into the vector ...
-
bioRxiv - Cell Biology 2020Quote: For derivation of HA-Smo and Smo-HA ESCs mouse Smo was amplified by PCR from the pGEN-mSmo (Addgene, #37673) and introduced in the PB-HA-IRES-Neo vector ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Reprogramming was carried out by transducing MEFs with a doxycycline-inducible mouse OKSM (pHAGE2-tetO-STEMCCA)(Sommer et al., 2009) and rtTA (FUdeltaGW-rtTA, Addgene 19780)(Maherali et al. ...
-
bioRxiv - Biophysics 2021Quote: ... HeLa cells were stably engineered to display a doxycycline-inducible GFP fused to a mouse CD80 transmembrane domain using standard second-generation lentivector production protocols and the plasmids pMD2G (Addgene 12259), pCMVR8.74 (Addgene 22036) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Cell Biology 2021Quote: ... The expression vector for N-terminally FLAG-tagged mouse SYDE2 was generated by PCR amplification of the coding sequence from pNICE HA-mSYD1B (Addgene #59362) and insertion into pcDNA3-FLAG by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904 ...