Labshake search
Citations for Addgene :
101 - 150 of 593 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... or a control virus (AAV5-hSyn-DIO-EGFP; Addgene, 50457-AAV5) targeting the CeA ...
-
bioRxiv - Systems Biology 2021Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444 ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Control vectors used were AAV-PHP.eB-hSyn-DIO-mCherry (Addgene #50459).
-
bioRxiv - Neuroscience 2021Quote: ... Control mice were instead injected with AAV8-hSyn-DIO-mCherry (Addgene).
-
bioRxiv - Neuroscience 2021Quote: ... AAV5 encoding GCaMP6f under the control of GFAP promoter (Addgene 52925) was used to target this calcium indicator to GFAP-expressing cells ...
-
bioRxiv - Neuroscience 2022Quote: ... 4μg of either control plasmid (“pCMV-Myc-GFP” plasmid, Addgene, 83375) or pCMV-Cre-GFP plasmid (“Cre Shine” plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... or control virus AAV-hSyn-EYFP (AddGene, 50465-AAV2, Watertown MA) into the CeA (−1.17 mm AP ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444 ...
-
bioRxiv - Cancer Biology 2023Quote: Control shRNA and shRNA against PTEN were purchased from Addgene (86645), Scramble siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... The scrambled control construct was acquired from Addgene (Plasmid no #26701).
-
bioRxiv - Cancer Biology 2024Quote: ... plasmid and the negative control pMSCV-Neo-GFP/Empty (Addgene #105505) were purchased on Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Microbiology 2022Quote: ... Dimeric human ACE2-IgG1 (hACE2) was generated by transfecting Expi293 cells with pcDNA3-sACE2-WT(732)-IgG129 (Addgene plasmid #154104, gift from Erik Procko) using 1 mg mL-1 PEI and then purifying from the supernatant five days post-transfection using rProtein A Sepharose (GE ...
-
Salinomycin inhibits epigenetic modulator EZH2 to enhance Death Receptors in Colon Cancer Stem CellsbioRxiv - Cancer Biology 2020Quote: ... Control and EZH2 (cat #24230) knockdown retroviral plasmid were brought from Addgene USA ...
-
bioRxiv - Neuroscience 2022Quote: ... or control virus pAAV-CaMKIIa-EGFP (Addgene Cat# 50469-AAV5, titer: 4.3x1012) into the CA2 using the following coordinates from Bregma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The control virus (AAV8-hSyn-DIO-mCherry, 2.3×1013 GC/mL, Addgene) was injected according to the same procedure ...
-
bioRxiv - Cell Biology 2021Quote: ... The FRET control plasmid pECFP18aaEYFP from addgene.) was used for setup (Addgene cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control Scramble shRNA sequence (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the same as that from Addgene Plasmid # 1864.
-
bioRxiv - Cell Biology 2019Quote: ... Thermo Fisher Scientific) or scrambled control (5’-CCTAAGGTTAAGTCGCCCTCG-3’, Addgene Plasmid #26701). Viral particles were produced from 293FT cells by co-transfection with viral vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... As a control AAV with the GFP-only construct was used (RRID:Addgene_49055). Virus particles were produced in HEK293FT (RRID_6911 ...
-
bioRxiv - Microbiology 2020Quote: ... and a control PLX304 vector was obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2021Quote: pEGFP-N1 (GFP coding plasmid used as control) was purchased from Addgene, and pEGFP-RNaseH1 (GFP-tagged RNase H1 coding plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with either a control pL-CRISPR.EFS.GFP (15µg, Addgene, 57818)78 or pL-CRISPR.EFS.GFP with cloned sgRNA sequences targeting Ascl1 (CRISPR1-F 5’CACCGCAACGAGCGCGAGCGCAACC-3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... or for control AAV5.EF1a.DIO.eYFP.WPRE.hGH (based on Addgene plasmid #27056, Penn Core) virus into the PRF of GlyT2-Cre mice unilaterally (AP:-4.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Knockdown studies utilized a non-targeting scramble control shRNA (Addgene; plasmid #46896), CDHR5 KD shRNA (TRC clone TRCN000054168 ...
-
bioRxiv - Systems Biology 2023Quote: ... Control shRNAs targeting luciferase or GFP were previously described (Addgene #83092, #83085) 33.
-
bioRxiv - Cell Biology 2023Quote: ... together with 100 ng of the Renilla luciferase control plasmid (Addgene, 118016). Transfections were performed using a Neon transfection kit (Thermo-Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The mCherry used as control was transcribed from the pCS2+8NmCherry vector (Addgene). In vitro transcription was performed using the mMESSAGE mMACHINE® SP6 Transcription Kit (Ambion ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: ... The plasmid encoding Control-TAG is available on Addgene (Addgene #138209, pcDNA3.1- (empty)-TAG) ...
-
bioRxiv - Cell Biology 2021Quote: The plasmids FUG-T2A-GFP-Cre and control GFP were purchased from Addgene #66691 and lentiviral particles were produced in HEK-293T cells using X-tremeGene 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with Super8X TOPFlash or Super8X FOPFlash (TOPFlash mutant control) (Addgene plasmids #12456 and #12457 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Contamination was simulated for the five Addgene plasmids chosen as our controls (Addgene IDs 31815 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Neuroscience 2021Quote: ... Control rAAV PHPs CAG mCherry was bought from Addgene (viral prep # 59462-PHP.S)
-
bioRxiv - Cancer Biology 2020Quote: ... EP300 gene or control(GE Dharmacon) and lentiviral vectors DR8.2 and VSVG (Addgene). Two and three days after transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... A non-targeting control shRNA vector (sh:SCR) was purchased from Addgene (Watertown, MA). Plasmids were packaged with the third-generation lentiviral packaging system (VSV-G ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats in control groups received either rAAV5/hSyn-DIO-mCherry (Addgene #50459, 0.75μl), saline (1.2μl ...
-
bioRxiv - Neuroscience 2022Quote: Proteotoxic genes and controls were cloned into either the pAG416GAL-ccdb (Addgene #14147) or pAG426GAL-ccdb (Addgene #14155 ...
-
bioRxiv - Physiology 2023Quote: ... CAG-NLS-GFP AAV.PHP.eB control AAVs were obtained from Addgene (CAT#: 104061-PHP.eB). Obesity or GFP fluorescence was induced via retro-orbital administration of AAV at a dose of 7×10^10gc/mouse under isoflurane anesthesia ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV8-hSyn-DIO-mCherry (Control virus; 2.3 x 1013 GC/ML, Addgene). Rats in Experiment 3 received a unilateral infusion of AAV8-rCRHp-iCre (200 nL ...
-
bioRxiv - Immunology 2023Quote: ... Variable regions were cloned into pVITRO1 plasmids that already contained the constant regions for human IgG1 heavy and light chains (κ or λ, Addgene plasmids #61883 and #50366)85 using Gibson Assembly75 ...
-
bioRxiv - Neuroscience 2022Quote: The commercial AAV5-hSynhM3D(Gq)-mCherry or the control virus AAV5-hSyn-mCherry (Addgene) were injected into the sciatic nerve of WT C57BL/6J mice (1μL/sciatic nerve ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864 ...
-
bioRxiv - Neuroscience 2019Quote: ... A control virus (AAV5-CamKIIα-eGFP, 4.1×1012) (Cat No. 50469-AAV5; Addgene, USA) was administered into the contralateral left EC using identical parameters ...
-
bioRxiv - Cell Biology 2021Quote: ... Either a control vector (c-Flag pcDNA3 was a gift from Stephen Smale (Addgene plasmid #20011 ...