Labshake search
Citations for Addgene :
351 - 400 of 1312 citations for En 1948 4 Marker Pcb Extraction Spike 13C12 99% 100 Ng Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... with 1000 ng plasmid containing inducible HGF (Addgene #188749) or a constitutive pEF1α-HGF (Addgene #188748 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 300 ng of pCAG-mTagBFP2 (Addgene plasmid #122373) were combined ...
-
bioRxiv - Immunology 2023Quote: ... and NG-ABE8e (gift from David Liu, Addgene #138491), and an in vitro transcrition (IVT ...
-
bioRxiv - Immunology 2024Quote: ... 500 ng of pCMV-VSV-G (Addgene plasmid #8454) and 1000 ng of cloned LentiCRISPRv2-Puro plasmid using Lipofectamine (5µl P3000 ...
-
bioRxiv - Immunology 2024Quote: ... electroporated with 10 ng pON-mCherry plasmid (Addgene, US) in 200 µl ddH2O using 2-mm cuvettes at 2.5 kV and 200 ν for 4 ms ...
-
bioRxiv - Physiology 2024Quote: ... or 200 ng pDisplay-ATP1.0-IRES-mCherryCAAX (Addgene, #167582) was transfected to HEK293T cells in 24-well plates ...
-
bioRxiv - Genomics 2024Quote: ... and transfected with 500 ng pMD-VSVg (Addgene #12259), 1,750 ng psPax2 (Addgene #12260) ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 ng of dead SaCas9 plasmid (Addgene no. 138162), 200 ng of SaCas9 sgRNA plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... pDSAP-aapp-hGrx1-roGFP2 and pDSAP-trio-DsRed) (~160 ng/µL) and the integrase helper plasmid carrying the Vasa2-ΦC31-Integrase gene (Addgene # 62299, ~200 ng/µL) diluted in 0.5x phosphate buffered saline (0.1 mM NaHPO4 buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and 500 ng plentiguide puro expression vector (Addgene cat # 52963), in a final volume of 20 mL with Opti-MEM ...
-
bioRxiv - Microbiology 2022Quote: ... The second solution contained 150 ng pCMV-VSVG (Addgene 8454), 400 ng psPAX2 (Addgene 12260) ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 ng pMD2.G (Didier Trono lab, Addgene plasmid #12259) and 5 μg of transfer plasmid per plate using polyethylenimine (Merck ...
-
bioRxiv - Biophysics 2020Quote: ... and 1250 ng of TMPRSS2 expression plasmids (Addgene plasmid #145843) in the 6-well plate ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Genetics 2022Quote: ... and pBS-Hsp70-Cas9 (442 ng/μL, Addgene plasmid #45945), which provided Cas9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 680 ng of pCD/NL-BH*DDD (Addgene plasmid # 17531) and either 340 ng of pCEF-VSV-G (Addgene plasmid # 41792 ...
-
bioRxiv - Biochemistry 2022Quote: ... and 500 ng of pRK5-HA-Ub-K6 (Addgene, #22900) for 24 h according to the manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 125 ng expression plasmid (pcDNA3-FOXO::FLAG, Addgene #13507) using manufacturer’s recommendations for lipofectamine 3000 ...
-
bioRxiv - Immunology 2021Quote: ... 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259) and 1 μg shRNA plasmid using Fugene 6 (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... NG-ABEmax was a gift from David Liu (Addgene #124163). SpG- and SpRY-ABEmax were a gifts from Benjamin Kleinstiverwas (Addgene plasmids #140002 and #140003) ...
-
bioRxiv - Genetics 2023Quote: ... 360 ng pMD2.g VSV-G envelope vector (Addgene #12259), and 1.2 ug of purified plasmid library using 5.8 uL of X-tremeGENE HPTM DNA Transfection Reagent (Millipore Sigma #06366236001) ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with either 500 ng of Super TOPFlash (Addgene) or Super FOPFlash (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... transfection reagent with 60 ng of LwaCas13a plasmid (Addgene ID 91924), 20 ng of gRNA plasmid (generated by cloning oligos into an LwaCas13a crRNA entry plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... and either 340 ng of pCEF-VSV-G (Addgene plasmid # 41792) or 680ng of 2.2 (Addgene plasmid # 34885 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 ng packaging plasmid psPAX2 (gift from Didier Trono, Addgene #12260), and 250 ng envelope plasmid pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 333 ng each of hCas9 (Addgene plasmid # 41815); 48 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µL plasmid DNA (ERmoxGFP43, Addgene Cat. # 68072, 420 ng/µL), and 96 µL of PBS ...
-
bioRxiv - Systems Biology 2019Quote: ... 90 ng pLR5-CBh-dCas9-hUtx-IRES-Hyg (Addgene, Plasmid #122374), 10 ng pCAG hyPBase [64] plasmids were transfected using Lipofectamine 3000 (Cat# L3000015 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 500 ng of pMD2.G (VSV-G) (Addgene plasmid #12259), using Lipofectamine 2000 at a ratio of 1:2.5 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... Cells were transfected with pMD2.G (500 ng, Addgene plasmid #12259), psPAX2 (1500 ng ...
-
bioRxiv - Microbiology 2023Quote: ... containing either 1000 ng empty vector (EV) (Addgene plasmid # 10841 (108)) ...
-
bioRxiv - Immunology 2024Quote: ... 200 ng of envelope plasmid (Addgene #8454; courtesy of Bob Weinberg), and 6 of μL polyethyleneimine (PEI ...
-
bioRxiv - Immunology 2024Quote: ... 800 ng of packaging plasmid (Addgene #8455; courtesy of Bob Weinberg), 200 ng of envelope plasmid (Addgene #8454 ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...
-
bioRxiv - Neuroscience 2019Quote: ... 125 ng of each DNA construct expressing BFP and ITGB1 (Addgene 51920) and 1.25μl of Lipofectamine LTX was used in each well (in a 24 well plate) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with 500 ng of LentiCrispR V2 (Addgene plasmid #52961) containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT ...
-
bioRxiv - Microbiology 2023Quote: ... 333 ng of the pMD2.G VSV-G expression vector (Addgene #12259), 200 µL serum-free DMEM ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Immunology 2023Quote: ... 250 ng VSV-G (a gift from Didier Trono, Addgene plasmid #12259), and 500 ng lentiviral transfer plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2400 ng psPAX2 (was a gift from Didier Trono, Addgene #12260), with lipofectamine 2000 for 24h ...
-
bioRxiv - Genomics 2024Quote: ... according to the manufacturers instructions with 200 ng pMD2.G (Addgene #12259), 600 ng psPAX2 (Addgene #12260 ...