Labshake search
Citations for Addgene :
601 - 650 of 1312 citations for En 1948 4 Marker Pcb Extraction Spike 13C12 99% 100 Ng Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP, 108vg/ml, Addgene #28304-PHPeB) at DIV 9-10 and processed for experiments 10-11 days later.
-
bioRxiv - Neuroscience 2023Quote: ... 1.3×1012 vg/mL) was mixed with AAV1-CAG-FLEX-EGFP-WPRE (Addgene; Cat # 51502; ≥ 1×1013 vg/mL) in a 4:1 ratio ...
-
bioRxiv - Neuroscience 2024Quote: ... 1.03 × 1013 vg/mL), and AAV-mCherry (pAAV9-hSyn-mCherry; 114472-AAV9, 9.0 × 1012 vg/mL) viruses were purchased from Addgene. AAV-Rem2-wt (AAV9-hSyn1-Myc-Rem2-WPRE ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... opsin construct), >1.3×1013 vector genomes/ml (Neuroscience Center Zurich, control construct) and 1.4 × 1013 GC/mL (Addgene, opsin construct). The viral vectors were aliquoted and stored at -80°C until stereotaxic injection surgeries.
-
bioRxiv - Neuroscience 2022Quote: ... AAV2 Ef1a-DIO-hChR2(H134R)-EYFP (4.2 × 1012 vg/ml, UNC, #AV4378) and AAV9 hSyn-ChrimsonR-tdTomato (2.6 × 1013 vg/ml, Addgene, #59171-AAV9).
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... Vglut2Cre/tdT mice received AAV2-hSyn-hChR2(H134R)-EYFP-WPRE-PA (Addgene; 100 nL) injections targeting the KF (Figure 3) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5/ml µg pMD2.G (Addgene: 12259) was prepared ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5-syn-GCaMP6s (titer: 1Χ1013 vg/mL, Addgene), or AAV.PHPeB-syn-GCaMP6s (titer ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV2-retro-CAG-tdTomato (7.0E12 GC/ml, Addgene) or AAV-PHP.S-CAG-tdTomato (1.7E13 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-mCherry (2.1×1013 vg/mL, Addgene). AAV2-retro-EF1a-DIO-FLPo (2.6×1013 vg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV5-CAG-mCherry (1.0 × 10e13 GC/ml, Addgene) and AAV5-EF1a-DIO-eYFP (1.0 × 10e13 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Undiluted AAV1-ChR2 (Addgene; 1013 vg/mL titre) was injected into right binocular V1 (bV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Undiluted AAV1-ChrimsonR (Addgene; 1013 vg/mL titre) or diluted (1:10 in saline ...
-
bioRxiv - Neuroscience 2024Quote: - AAV2retro hSyn.Cre.WPRE.hGH (1.8 × 1013 gp/ml) (Addgene #105553)
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-mCherry (Addgene, 50459, vg/mL), pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Neuroscience 2023Quote: ... oligonucleotide pairs (Extended Data Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Synthetic Biology 2023Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ; http://n2t.net/addgene:140957 ; RRID:Addgene_140957)
-
bioRxiv - Neuroscience 2023Quote: ... Mice were injected at 4 weeks of age with pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene viral prep # 105551-AAV9) in the right hemisphere to silence Tsc1 gene and pENN.AAV9.CamKII0.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following lentiviral vectors were used at an MOI of 4 (96h): pWPXL-SOX4 (Addgene 36984), HA-tagged SOX4 [43] or empty vector control (Addgene 12257) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 1:1 mixture (100 nl total) of either retrograde AAV-hSyn-DIO-eGFP (Addgene) and AAV2-hSyn-mCherry (UNC vector core ...
-
bioRxiv - Neuroscience 2023Quote: ... and injections of 100 nl of GCaMP7s (pGP-AAV1-syn-jGCaMP7s-WPRE, Addgene plasmid #104487) diluted 1/3 in PBS were made at 50 nl/min at five locations separated by 200-250 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5, 1.7×e13 gene copies/mL) or pAAV-hSyn-EGFP (#50465, AAV5, 1.2×e13 gene copies/mL) (Addgene, Inc., Watertown, MA, USA) were diluted to 8.5×e11 gene copies/mL using PBS (Gibco® Dulbecco’s phosphate-buffered saline ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...