Labshake search
Citations for Addgene :
2201 - 2250 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... David Virshup and Xi He from the plasmid kit73 (Addgene kit # 1000000022). HALO*EBP-HA and HALO*EBP constructs were originated from a pBSM13-Pax7HALO plasmid that was designed in our lab ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast Toolkit plasmids were a gift from John Dueber (Addgene kit # 1000000061). pAJ4619 was made from pAJ4618 by inverse PCR using oligos AJO3551 and AJO3539 ...
-
bioRxiv - Plant Biology 2024Quote: ... The MoClo Toolkit was a gift from Sylvestre Marillonnet (Addgene kit # 1000000044) (Weber et al ...
-
bioRxiv - Cell Biology 2019Quote: Fluorescent protein sequences were obtained from lab stocks with the exception of mTagBFP2 which was amplified from mTagBFP2-pBAD (Addgene, Watertown, USA; plasmid ID 54572). The 3mTagBFP2 was a kind gift from Serge Pelet (University of Lausanne ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Systems Biology 2021Quote: ... individual drivers were PCR amplified out of the Cancer Pathways kit (Addgene #1000000072)21 ...
-
bioRxiv - Biochemistry 2021Quote: ... The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070). GST tagged RAF1-RBD (GST-RAF-RBD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we performed two-step cloning using a Platinum Gate TALEN kit (Addgene, #1000000043). In the assembly-step 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The ENO1 terminator fragment was amplified from pYTK051 (Addgene Kit #1000000061 position E3) (Lee et al ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Mammalian Toolkit was a gift from Hana El-Samad (Addgene kit #1000000180). For continuous propagation of cells containing the CHYRON locus ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were generated using three plasmids to ensure a single round of infectivity: a pseudotyping plasmid for transient expression of the VSV-G envelope protein (pMD2.G, Addgene plasmid #12259, gift from Didier Trono), a plasmid for transient expression of the viral gag/pol ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Cancer Biology 2020Quote: ... KIT D816V ESCs were generated as described previously using the pX335 vector (Addgene 42335) and oligonucleotides listed in supplemental Table 3.29
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat. # 1000000060) (54).
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Genetics 2023Quote: ... To generate vectors for the protein stability assay DNMT3B and mutant sequences were cloned into pLenti-DsRed-IRES-EGFP (Addgene plasmid 92194, a gift from Huda Zoghbi).
-
bioRxiv - Synthetic Biology 2022Quote: ... The BGA polyadenylation signal was amplified from plasmid C7 (MXS Chaining Kit; Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Synthetic Biology 2021Quote: All remaining plasmids were generated using Goldengate cloning with the MoClo toolkit (Addgene Kit#1000000044) as described in Weber et al ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gβ and Gγ-GFP2 constructs were purchased as part of the TRUPATH kit from Addgene.
-
bioRxiv - Systems Biology 2024Quote: ... Gβ3 and Gγ9-GFP2 were purchased as part of the TRUPATH biosensor kit from Addgene. The oligonucleotides for making the GαsE392K-Rluc8 and GαsL388R-Rluc8 mutations were designed using Agilent Technologies’ online primer design tool ...
-
bioRxiv - Molecular Biology 2023Quote: ... cerevisiae Advanced Gateway™ Destination Vectors were a gift from Susan Lindquist (Addgene kit #1000000011).
-
bioRxiv - Synthetic Biology 2022Quote: ... and terminator parts used in the constructs described were provided by Douglas Densmore (Addgene kit 1000000059).
-
bioRxiv - Biophysics 2020Quote: We assembled TALE-TF with the Golden Gate TALEN and TAL Effector Kit2.0 (Addgene kit #1000000024) 101 as previously described 23 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit; Addgene reference #62421).
-
bioRxiv - Biochemistry 2022Quote: ... The Saccharomyces cerevisiae Advanced Gateway Destination Vector Kit was purchased from Addgene (Watertown, MA, United States). Phusion high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2022Quote: ... This plasmid was then used as a template for Golden Gate-based cloning (MoClo Plant Kit, Addgene) (47) ...
-
bioRxiv - Plant Biology 2024Quote: Designer TALEs were constructed using the Golden Gate TALEN and TALE Kit 2.0 (Addgene, Watertown, MA, USA) according to the manufacturer’s protocol79 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2020Quote: We employed a two-step Golden Gate assembly method using the Platinum Gate TALEN Kit (Addgene; cat#1000000043) to construct Platinum TALEN plasmids containing the homodimer-type FokI nuclease domain ...
-
bioRxiv - Molecular Biology 2021Quote: ... the inserts from the entry clones were subcloned into pAG413GAL-ccdB and pAG416GAL-ccdB vectors (Addgene kit #1000000011) [31] by LR Gateway reaction (Invitrogen™) ...
-
Reconstitution of prospermatogonial specification in vitro from human induced pluripotent stem cellsbioRxiv - Developmental Biology 2020Quote: ... TALEN constructs targeting DDX4 were generated using a Golden Gate TALEN and TAL Effector kit 2.0 (Addgene, #1000000024)69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The annealed oligo products were directionally cloned into the Addgene Multiplex CRISPR/Cas9 Assembly Kit (Addgene, Watertown, MA) as crRNA genes for sgRNA expression ...
-
bioRxiv - Cell Biology 2024Quote: alix and tsg101 were amplifed from cDNA using the Bio-Rad iScript kit and cloned into pJC53.2 (RRID:Addgene_26536) as previously described26 ...
-
bioRxiv - Plant Biology 2024Quote: ... The platinum TALEN ORFs designed to recognize the target sequences were assembled by platinum gate assembly kit (Addgene) (Sakuma et al. ...
-
bioRxiv - Cancer Biology 2023Quote: WNT3A and WNT4 were sub-cloned by Gateway recombination from the open-source Wnt library (Addgene Kit #1000000022) to the MAC-Tag-C vector (Addgene #108077 ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Biochemistry 2020Quote: ... TALENs were assembled using the Golden Gate TALEN and TAL Effector Kit 2.0 (57) and employing pC-GoldyTALEN as the final expression vector (#1000000024 and #38143 respectively; both from Addgene). Correct assembly of TALEN plasmid DNA was verified by restriction site analysis and sequencing and TALEN plasmids were transfected into wild type HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Plant Biology 2022Quote: ... p35S:MPTMV-YFP + ERmCherry and p35S:MPToBRFV-YFP + ER-mCherry were assembled by Golden Gate cloning using the MoClo tool kit for plants (Addgene) (Weber et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... a region extending from the gene upstream of the transcription start site of a candidate gene plus the first exon and intron of that gene was fused to the sequence of GFP in plasmid pPD95.75 (Fire Vector kit, Addgene) which also contains the unc-54 3’UTR ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... TALENs were constructed according to the instruction provided by the TALE Toolbox kit from the Zhang laboratory (Sanjana et al., 2012) (Addgene, #1000000019). The target sequences for the left arm ...