Labshake search
Citations for Addgene :
2101 - 2150 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: Single-cycle viruses were generated from three plasmids: two plasmids for transient expression of the VSV-G pseudotyping envelope protein (pMD2.G, Addgene #12259) and viral gag-pol ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cas9 editing efficiency in all cell lines was confirmed to be >90% based on tests using the fluorescent protein editing reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980).
-
bioRxiv - Bioengineering 2024Quote: ... microchannels were seeded with Madin-Darby Canine Kidney (MDCK; ATCC) epithelial cells or MDCK cells transduced to express mCherry fluorescent protein (MDCKmCherry, Addgene: 72264). Both MDCK types were cultured in DMEM supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... TALENs were assembled using the Golden Gate TALEN kit (Addgene) per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... which was a gift from Paul Freemont (Addgene kit #1000000080). The Golden Gate digestion/ligation reactions and cycling were carried out as described by the kit (Moore et al ...
-
bioRxiv - Neuroscience 2020Quote: ... and constructs contained in the TALE Toolbox (Addgene kit # 1000000019), a gift from Feng Zhang ...
-
bioRxiv - Microbiology 2021Quote: ... along with sgRNA and other SapTrap-SEC kit plasmids (Addgene)61 ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Microbiology 2020Quote: ... The MoClo Yeast Toolkit25 was obtained from Addgene (Kit # 1000000061) and was a gift from Prof ...
-
bioRxiv - Biochemistry 2021Quote: ... cerevisiae Advanced Gateway Destination Vector Kit were obtained from Addgene. Expand high fidelity PCR system (Roche Life Science ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was a gift from John Dueber (Addgene kit # 1000000061). The assembly reaction conditions were 50 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was a gift from John Dueber (Addgene kit # 1000000061). Note that the insert sequences were amplified in two separate fragments ...
-
bioRxiv - Cell Biology 2023Quote: ... TRUPATH was a gift from Bryan Roth (Addgene kit #1000000163) (27) ...
-
bioRxiv - Genetics 2020Quote: ... The C-terminal portion of the hygromycin resistance gene and the unc-54 3’ UTR were then independently amplified from pCFJ1663 (Addgene #514840 from the lab of Erik Jorgensen) and inserted into the SbfI site of pMS4 to create the final landing pad plasmids (pMS70-75) ...
-
bioRxiv - Cancer Biology 2021Quote: We generated pX330 Mettl3 vector by cloning the previously described sgRNA targeting mouse Mettl316 into the pX330 plasmid (Addgene Plasmid #42230). The pX330 plasmid was digested using BbsI and a pair of partially complementary annealed oligos containing overhangs from BbsI site and Mettl3 sgRNA sequence were cloned scarlessly into the vector ...
-
bioRxiv - Cell Biology 2020Quote: For derivation of HA-Smo and Smo-HA ESCs mouse Smo was amplified by PCR from the pGEN-mSmo (Addgene, #37673) and introduced in the PB-HA-IRES-Neo vector ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Reprogramming was carried out by transducing MEFs with a doxycycline-inducible mouse OKSM (pHAGE2-tetO-STEMCCA)(Sommer et al., 2009) and rtTA (FUdeltaGW-rtTA, Addgene 19780)(Maherali et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The expression vector for N-terminally FLAG-tagged mouse SYDE2 was generated by PCR amplification of the coding sequence from pNICE HA-mSYD1B (Addgene #59362) and insertion into pcDNA3-FLAG by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form the Mouse Brie CRISPR knockout pooled library (a gift from David Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Supplementary Figure 1A) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Microbiology 2022Quote: The mouse Brie pooled sgRNA library on the lentiGuide-Puro backbone was obtained from David Root and John Doench (Addgene #73633) (23) ...
-
bioRxiv - Genetics 2023Quote: The gRNA library used for the screening was the Mouse Improved Genome-wide Knockout CRISPR Library v2 (a gift from Kosuke Yusa, Addgene, #67988) (48) ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Developmental Biology 2023Quote: Single guide RNAs (sgRNAs) targeting each of the specific target genes were retrieved from the Mouse CRISPR Knockout Pooled Library (Addgene #73632). Two sgRNA sequences were selected per gene of interest (for sgRNAs sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were selected from either the Brunello (human) or Brie (mouse) libraries and cloned into either lentiCRISPR v2 or lentiCRISPR v2-Blast (Addgene #83480). Lentivirus was produced and used to infect indicated cell lines ...
-
bioRxiv - Developmental Biology 2024Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides were cloned into either the pX602-AAV-Cre sgRNA backbone for CRISPR/Cas9-induced acute gene knockout in mouse liver or the pLentiCRISPR V2 (Addgene, 52961) & pLentiGuide Blast for genome editing in cell lines ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Microbiology 2020Quote: ... and the matrix protein from vesicular stomatitis virus was amplified from pVSV eGFP dG (a gift from Connie Cepko; Addgene plasmid #31842) as described above using the primers listed in Table S2 ...
-
bioRxiv - Developmental Biology 2021Quote: Tol2-enhanced green fluorescent protein (EGFP)-C1 was prepared by digesting pT2-7xTcf-NLS-CNL-CP (a gift from Yasushi Okada (Addgene plasmid #65715), Takai et al ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 nucleotide guide RNA (gRNA) sequence targeting the IRF7 protein-coding region was inserted into the lentiCRISPRv2 vector (Addgene; catalog #52961). The IRF7 guide sequences used was ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei of opsin-positive cells were visualized using a Histone2B fusion protein with mTFP1 (a gift from Robert Campbell & Michael Davidson; Addgene plasmid # 54553; http://n2t.net/addgene:54553;RRID:Addgene_54553; Ai at al., 2006).
-
bioRxiv - Neuroscience 2022Quote: ... an enhanced green fluorescent protein (eGFP) under the CaMKIIα promoter was used (AAV9-CaMKIIα-eGFP-WPRE; Addgene #50469, 2.4E+13 GC/mL). We infused the AAV in the dorsal hippocampus through the following coordinates relative to bregma ...
-
bioRxiv - Physiology 2022Quote: ... An optimized rat insulin promoter (RIP) (50) and the coding sequence of hM4D(Gi)-mCherry (Gi/o-coupled DREADD-mCherry fusion protein; Plasmid #75033; Addgene, Watertown, MA) (80 ...