Labshake search
Citations for Addgene :
2151 - 2200 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... media was refreshed with standard growth media and cells were co-transfected with SNAP-mGluR2 (no FLAG-tag) and chimeric G protein (Gqo5, Addgene plasmid #24500) (1:2 w/w ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Developmental Biology 2022Quote: The pTT3-eGFP vector was constructed by replacing the C-terminal tag encoding region of a bait protein vector (52) (Addgene ID 36150) with eGFP ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339), green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340), or azurite (pLV-Azurite, plasmid # 36086) (Addgene, Cambridge, Massachusetts)39,40 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339) or green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340) (Addgene, Cambridge, Massachusetts). To load the microfluidic device ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Neuroscience 2022Quote: ... an injection of AAV1 carrying a fused channelrhodopsin2-YFP protein (AAV1-hSyn-ChR2-H134R-eYFP- WPRE, Addgene, viral prep no. 26973-AAV1) was placed into either MEC ...
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Molecular Biology 2023Quote: ... the N-terminal part of FUS protein was used from the plasmid pHR-FUSN-mChr-CRY2WT (a gift from Clifford Brangwynne; Addgene plasmid # 101223). The N-terminal part of SATB1 was cloned into the pCMV-CRY2-mCherry vector using a single BspEI restriction enzyme site from the full-length construct ...
-
bioRxiv - Physiology 2023Quote: ... with the carboxy tail fused to either the N-fragment (VN) or the C-fragment (VC) of the Venus protein (27097, 22011; Addgene, Cambridge, MA), auxiliary subunits CaVα2δ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sequences were removed from the pMXPIE-AID retroviral vector [67] and the resulting backbone was linked to the orange fluorescent protein gene mOrange2 (from Addgene, plasmid # 45179) [68] ...
-
bioRxiv - Cell Biology 2023Quote: ... An expression vector for dominant negative KASH (DN-KASH)-mCherry fusion protein was a gift from Daniel Conway (Virginia Commonwealth University, Addgene plasmid #125553) [56] ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2019Quote: ... David Virshup and Xi He (Addgene, Watertown, MA, USA, kit #1000000022) (8) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the Target Accelerator Pan-Cancer Mutant Collection (Addgene Kit #1000000103)29.
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Physiology 2024Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Molecular Biology 2024Quote: ... A SRCAP gRNA designed using CRISPOR117 to target the C-terminal part of mouse SRCAP was added in pX330-gRNA vector (pX330-gRNA was a gift from Charles P. Lai (Addgene plasmid #158973)) by digestion with BbsI to build pX330_SRCAP ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the ELOVL7 protein (Uniprot ID: A1L3×0) was cloned into the baculovirus transfer vector pFB-CT10HF-LIC (available from The Addgene Nonprofit Plasmid Repository) for expression in Sf9 cells (Thermo-Fisher Scientific ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... vector expressing a constitutively active form of AMPKa (AMPKα21-312) and GFP (Green Fluorescent Protein) or a control AAV vector (Addgene: plasmid # 60127 and # 50465) were injected bilaterally in the BLA at P35 ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SUMO-SpyTag003 (N-terminal His6 tag-SUMO protein-SpyTag003) was cloned previously by Irsyad Khairil Anuar (University of Oxford) (GenBank and Addgene deposition in progress). pDEST14-SpyCatcher003-TEVs-SpyTag003DA (‘Masked SpyCatcher0003’ ...
-
bioRxiv - Immunology 2023Quote: Expi293F cells were cultured and transiently transfected with the pLenti-palmGRET reporter plasmid encoding the dual reporter palmitoylated EGFP-nanoluciferase protein (PalmGRET) (Addgene plasmid #158221 11) for EV production as described previously 23 ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Cas9 protein was produced by the Weizmann Institute of Science Protein Purification Unit using the pET-28b-Cas9-His (Alex Schier Lab Plasmids, Addgene, Cambridge, MA, United States) as a template ...
-
bioRxiv - Neuroscience 2019Quote: ... Similar experiments were conducted using mammalian PSD-95 protein (prepared by transfecting expression vectors pCMV-PSD95-flag [FLAG-tagged; Addgene, #15463] into HEK293 cells) bound to GluN2B-peptide-containing Agarose resins ...
-
bioRxiv - Biophysics 2022Quote: ... the RNA-guided targeting of genes was achieved through coexpression of the Cas9 protein with gRNAs using reagents from the Church group48 (Addgene: http://www.addgene.org/crispr/church/). Targeting sequences of the gRNAs were as followed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119) [25] ...
-
bioRxiv - Neuroscience 2019Quote: ... using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene 1000000024). TALEN mRNAs were synthesized by in vitro transcription using the mMessage mMachine SP6 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119). Various parts from the toolkit were used for construction of the vectors ...