Labshake search
Citations for Addgene :
1901 - 1950 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900; http://n2t.net/addgene:127900; RRID:Addgene_127900) and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine ...
-
bioRxiv - Biochemistry 2024Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663; http://n2t.net/addgene:13663 ; RRID:Addgene_13663). The mouse Src gene was subcloned into the pEGN Bacmam vector(45) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid kit used for the generation of TALENs was a gift of Daniel Voytas and Adam Bogdanove (Addgene kit #1000000016). Plasmid encoding assembled TALENs was linearized with SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP tagged OsHIPP19 and OsHIPP20 were generated by Golden Gate methods (Engler et al. 2008) using MoClo Plant Parts Kit and MoClo Plant Tool Kit (Addgene, UK). OsHIPP19 and OsHIPP20 were cloned into pICH47732 with a GFP tag at the N-terminus ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids encoding GPCRs were obtained from various sources (as indicated Key Resources Table) or subcloned into pcDNA3.1 from the PRESTO-Tango GPCR kit (Addgene Kit #1000000068) as described next ...
-
bioRxiv - Cell Biology 2023Quote: ... were constructed in according to Golden Gate TALEN assembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene, Kit #1000000024). CIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... Plasmid construction was performed by modular cloning using the MoClo Tool Kit and the MoClo Plant Parts Kit (Addgene, 28–30). A detailed MoClo protocol and the list of vectors used can be found in 18.
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774; http://n2t.net/addgene:45774; RRID:Addgene 45774). TetR was fused to the green fluorescent protein variant deGFP and measured using excitation and emission at wavelengths 485 nm and 525 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were packaged by co-transfection of the transfer plasmid encoding the protein of interest with psPAX2 (Addgene #12260) and pVSVG (Addgene # 35616 ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The β-arrestin2 green fluorescent protein (GFP) plasmid DNA was originally created by Robert Lefkowitz and obtained from Addgene (plasmid #35411 ...
-
bioRxiv - Cancer Biology 2020Quote: ... MSCV vector containing either nothing (empty vector) or the CTAG1A gene were co-transfected in 293FT with pMD2.G and pUMVC (Addgene #8449, gift from Bob Weinberg) at a ratio of ∼1.5:1.2:1.8 ...
-
bioRxiv - Neuroscience 2022Quote: ... with a double inverted open reading frame containing the excitatory DREADD fused to mCherry hM3D(Gq)-mCherry (AAV5-hSyn- DIO-hM3Dq-mCherry, Addgene plasmid #44362, Watertown, MA, USA) or the inhibitory DREADD fused to mCherry hM4D(Gi)-mCherry (AAV5-hSyn-DIO-hM4Di-mCherry ...
-
bioRxiv - Microbiology 2022Quote: Lentivirus was produced in HEK293T by co-transfection of cDNA containing lentiviral plasmid together with helper plasmids pMD2.G (Addgene #12259, gift from Didier Trono) and pCMV-dR8.91 (Life Science Market ...
-
bioRxiv - Microbiology 2020Quote: ... A miniTn7 element containing dcas9 was constructed by PCR-amplifying the tetR-tetP-dcas9-rrnBT1-T7Te fragment from pdCas9-bacteria (Addgene #44249, gift of Stanley Qi) with primers containing SpeI and PstI sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... The amplifications of three PCR fragments containing four gRNA sequences (Fig. S5) with the respective primers and pCFD6 as a template (Addgene plasmid # 73915; from Simon Bullock), followed by Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Systems Biology 2022Quote: DNA oligos (Integrated DNA Technologies) containing gRNA sequences complementary to MORC3 or SETDB1 genomic loci were annealed and ligated into pX458 (Addgene #48138, gift from Feng Zhang). A549 cells were transfected with pX458 constructs using Lipofectamine 3000 and two days later GFP-positive cells were single-cell sorted into 96-well plates containing complete media ...
-
bioRxiv - Cancer Biology 2023Quote: Retrovirus vectors were generated by co-transfecting the LKB1-containing plasmids with the pCMV-VSV-G packaging plasmid (Addgene 8454, a gift from Robert Weinberg) into GP2-293 cells (Takara 631458) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...