Labshake search
Citations for Addgene :
2001 - 2050 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Flag-tagged mTOR (Plasmid #26603) and HA-tagged Raptor (Plasmid #8513) were purchased from Addgene. Transfection were performed with the TransIT-X2 Transfection Reagent (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613; Addgene plasmid # 60614; http://n2t.net/addgene:60614; RRID:Addgene_60614 ...
-
bioRxiv - Microbiology 2022Quote: The CRISPR-Cas9 construct of this study was derived from pCas9 plasmid (Addgene plasmid #42876) and assembled onto P1 phagemid via Gibson assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bernard Weinstein (Addgene plasmid # 21232; http://n2t.net/addgene:21232; RRID:Addgene_21232; Addgene plasmid # 21234; http://n2t.net/addgene:21234; RRID:Addgene_21234 ...
-
bioRxiv - Neuroscience 2022Quote: ... pDestTol2pACryGFP and pDESTtol2pACrymCherry plasmids were gifts from Joachim Berger & Peter Currie (Addgene plasmids # 64022, 64023). The expression constructs were co-injected with tol2 transposase mRNA into 1-cell zebrafish embryos (Kwan et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sgRNA/Cas9 plasmids used the px330 plasmid (Addgene 42230, deposited by Dr. Feng Zhang) (Ran et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used STAT3C lentiviral plasmid and control GFP plasmid purchased from Addgene (Supplemental Table S2). STAT3C carries a mutation that constitutively activates STAT3 ...
-
bioRxiv - Neuroscience 2022Quote: The V5-TurboID-NES_pCDNA3 and plasmid is a gift from Alice Ting (Addgene plasmid #107169). Plasmids were transformed using a competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Cell Biology 2023Quote: PCR products from plasmids GFP-AHPH-WT (a gift from Michael Glotzer, Addgene plasmid # 68026) and GFP-AHPH-DM (a gift from Alpha Yap ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid for inserting transgene into mouse genome: pBT378_pattB-pCA-GFP-pA-attB plasmid (Addgene, 52554).
-
bioRxiv - Cancer Biology 2022Quote: WWOX expression was knocked out using the LentiCRISPR-V2 plasmid (Addgene plasmid # 52961, Massachusetts, USA), which contains the sgRNA sequence that targets WWOX exon 1 [5’-CACCGCATGGCAGCGCTGCGCTACG-3’]52 ...
-
bioRxiv - Immunology 2023Quote: ... whereas mCherry1-10-RNase L was inserted into pLenti-PGK-PuromycinR plasmid (Addgene: Plasmid #19070). The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... coli transformed with plasmid pDZ2087 (pDZ2087 was a gift from David Waugh, Addgene plasmid # 92414)(29) ...
-
bioRxiv - Cancer Biology 2023Quote: pSpCas9(BB)-2A-GFP (px458) plasmid was a gift from Feng Zhang (Addgene plasmid #48138). The designated sgRNA sequences for each of the targeted genes were cloned into px458 using combinations of top and bottom oligonucleotides listed below.
-
bioRxiv - Developmental Biology 2023Quote: ... cells were transfected with plasmids encoding hNICD3(3xFLAG)-pCDF1-MCS2-EF1-copGFP (Addgene plasmid #40640) or pcDNA3.1(- ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVretro-CAG-FLPo and AAV-CAG-FRT-rev-TdTomato were gifts from Janelia Viral Tools (Addgene plasmid #183412, http://n2t.net/addgene:183412, RRID:Addgene_183412; Addgene plasmid #191203, http://n2t.net/addgene:191203, RRID:Addgene_191203). The titers of each virus were as follows (in genomic copies/mL) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentivirus packaging vectors pCMV-VSV-G (plasmid #8454) and psPAX2 (plasmid #12260) were from Addgene. Retroviral supernatants were produced by transient calcium phosphate transfection of NIH-293T cells with pCL-ECO (Imgenex ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... This was obtained from the pJM230 plasmid69 (obtained from the Addgene plasmid repository, plasmid #110560). Overnight cultures of each strain were set up in biological triplicate ...
-
bioRxiv - Cancer Biology 2023Quote: The pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (a gift from Feng Zhang (Addgene plasmid #42230)) was modified to express a bicistronic peptide containing Cas9 and Cre as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting plasmid (pLentiCRISPRv2-sgAhR) was transfected along with support plasmids pMD2.g (Addgene #12259), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Microbiology 2023Quote: The miRNA over-expression plasmids and miR-92a mutation/deletion plasmids were obtained from Addgene vector repository ...
-
bioRxiv - Cancer Biology 2023Quote: ... with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260). 16 h posttransfection ...
-
bioRxiv - Biophysics 2023Quote: Anti-EGFP nanobody plasmid (pOPINE GFP) was a gift from Brett Collins (Addgene plasmid #49172)43 and transformed into BL21 cells for purification ...
-
bioRxiv - Microbiology 2023Quote: The plasmid encoding the codon-optimized T7 polymerase was obtained from Addgene (plasmid 65974; (34)) as was the VSV-G plasmid (pMD2.G ...
-
bioRxiv - Cell Biology 2023Quote: ... The AP1 luciferase reporter plasmid was a gift from Alexander Dent (Addgene plasmid #40342; 3XAP1pGL3), the NF-κB luciferase reporter was purchased from Promega (#E8491) ...
-
bioRxiv - Microbiology 2023Quote: ... that were a gift from Carol Gross & Jason Peters & Oren Rosenberg (Addgene plasmid # 119239; http://n2t.net/addgene:119239; RRID:Addgene_119239 - Addgene plasmid # 119262; http://n2t.net/addgene:119262; RRID:Addgene_119262) with E.coli MFD strain as donor ...
-
bioRxiv - Cell Biology 2023Quote: ... miniTurbo containing plasmid 3xHA-miniTurbo-NLS_pCDNA3 was a gift from Alice Ting (Addgene plasmid # 107172). miniTurbo gene (primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The retroviral Centrin2-GFP expression plasmid was kindly provided by YIain Cheeseman (Addgene plasmid, 69745), while the retroviral Nek2 plasmid was acquired from DNASU (Backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-PLK4 cDNA (CDS) was cloned into the lentiviral pCW57-hygro plasmid (Addgene plasmid, 80922) by double digestion with NheI and BamHI and ligation with T4 ligase ...
-
bioRxiv - Immunology 2023Quote: ... Mtb was transformed with the pTEC15 plasmid (a gift from Lalita Ramakrishnan; Addgene plasmid # 30174)93 or the pMSP12::mCherry plasmid (a gift from Lalita Ramakrishnan ...
-
bioRxiv - Immunology 2024Quote: The plasmid pHIV-EGFP was gifted by Bryan Welm and Zena Werb (Addgene plasmid #21373), and pMD2.G and psPAX2 were gifted by Didier Trono (Addgene plasmid #12259 and #12260) ...
-
bioRxiv - Immunology 2024Quote: ... Plasmids with correct insert were cloned into a lentivirus backbone destination vector (Addgene, plasmid 17451) with LR Clonase II Enzyme Mix (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... all plasmids deposited to Addgene were independently subjected to whole-plasmid sequence confirmation by Addgene.
-
bioRxiv - Biochemistry 2024Quote: PancACe and cpGFP were subcloned from the pET28 plasmid into the pLJM1 plasmid (Addgene #19319), and the localization tags were added via primers.
-
Spray-induced gene silencing (SIGS) as a tool for the management of Pine Pitch Canker forest diseasebioRxiv - Plant Biology 2024Quote: ... USA) and cloned into the T777T plasmid (Addgene plasmid # 113082; http://n2t.net/addgene:113082; RRID:Addgene_113082) which contains two IPTG-inducible T7 promoter (5’-TAATACGACTCACTATAG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: Sox2se-CPG-TV-dTomatto and Gapdh-CpG-TV-GFP plasmids (Addgene plasmid # 70155, and 70148) were a gift from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid for CDH11 was synthesized and cloned by GeneScript on EPB71 vector (Addgene plasmid #90018).
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790, Addgene_171824 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ovalbumin-expressing B16F10 (B16F10-OVA) was established with pCI-neo-mOVA plasmid (Addgene plasmid #25099) and selected with 1 mg/ml of G418 for 2 weeks as previously described.42,43 All cell lines were maintained at < 70% in culture and tested for mycoplasma contamination every 2 weeks according to MCTP standard protocols.
-
bioRxiv - Cancer Biology 2019Quote: p53 R248Q was PCR amplified from a bacterial expression plasmid (kind gift of Dr. Shannon Laubert, UCSD) and KRASG12D the pBabe-KRASG12D plasmid (Addgene plasmid 58902, from Dr. Channing Der) using the Kappa Hi-fidelity DNA polymerase (Kappa Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... NG-ABEmax-encoding plasmid wasconstructed in our lab based on the appropriate backbone plasmids (Addgene # 112095).
-
bioRxiv - Immunology 2021Quote: pX330-U6-Chimeric_BB-CBh-hSpCas9 (Plasmid #42230) and lentiCRISPR v2 (Plasmid #52961) were purchased from Addgene. EGFP-tagged mouse NLRP3 was cloned into pBOB empty vector using ligation-independent cloning (LIC ...
-
bioRxiv - Cancer Biology 2019Quote: ... These were then co-transfected with an hCas9 plasmid (gift from George Church, Addgene plasmid #41815). gRNA sequences can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Other plasmids used (for details see excel file S1): pLenti Lifeact-iRFP670 BlastR43 (Addgene Plasmid #84385); pGIZ-PuroR-IRES-GFP_shRNA anti Rab11a/b (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... that result in frameshift mutations were designed using the CRISPR.mit.edu design software and cloned into the Cas9.2A.EGFP plasmid (Plasmid #48138 Addgene). Transfection of gRNA Cas9.2A.EGFP constructs was carried out with Lipofectamine 2000 (ThermoFisher Scientific 11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2022Quote: ... mKeima-Red-Mito-7 plasmid was a gift from Michael Davidson (Addgene plasmid #56018; www.addgene.org/56018). MitoTracker Deep Red FM ...