Labshake search
Citations for Addgene :
1851 - 1900 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... both obtained from Addgene (Addgene plasmids #103973 and #54531) 50,51 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid pJL1-sfGFP (Addgene #102634) was used as a control for CFPS activity ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were obtained from Addgene. Candidates were selected using the dominant Roller phenotype and hygromycin resistance ...
-
bioRxiv - Cell Biology 2023Quote: ... pMDLg/pRRE (Addgene plasmid #12251), and pMD2.G (Addgene plasmid #12259).
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids purchase from Addgene what listed in Supplementary Table S4 ...
-
bioRxiv - Immunology 2023Quote: ... IgG3 (Addgene plasmid #61885; RRID:Addgene_61885), and IgG4 (Addgene plasmid #61887 ...
-
bioRxiv - Cell Biology 2023Quote: pBABE-Puro (Addgene, Plasmid #1764), pBABE-Puro-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... (Addgene plasmid # 128257; RRID: Addgene_128257). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Immunology 2023Quote: ... The pX335 plasmid (Addgene #42335) was used to generate a DNA template for sgRNA in vitro transcription ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the pLIB plasmid (Addgene_80610) between BamHI and SalI sites.
-
bioRxiv - Genetics 2023Quote: ... and psPAX2 (Plasmid #12260, Addgene) plasmids in a mass ratio of 0.5/0.5/1.0 for a total of 2µg ...
-
bioRxiv - Cell Biology 2023Quote: ... pLyn11-FRB (Addgene plasmid #20147),68 and pCMV-mCherry-FKBP-INPP5E44 using 293fectin at a 1:1:1:1 ratio (each 0.25 µg) ...
-
bioRxiv - Cancer Biology 2023Quote: ... FASN shRNA1 plasmid # 82327(Addgene); FASN shRNA2 _ TRCN0000002125 (Horizon) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Qing Zhong (Addgene plasmid 28027) (44) ...
-
bioRxiv - Cell Biology 2023Quote: ... (Addgene plasmid # 128257; RRID: Addgene_128257). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Microbiology 2024Quote: ... pMD2G (plasmid no. 12259; Addgene), and psPAX2 (plasmid no ...
-
bioRxiv - Microbiology 2024Quote: ... and ΔR8.2 (Addgene plasmid # 8455) plasmids for lentivirus generation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Geir Mathiesen (Addgene plasmid # 122030). E ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag_HsIRE1a_pBabePuro (Addgene, Plasmid #54337) were purchased from Addgene (Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... or pCoPuro (Addgene plasmid #17533) and selecting in the presence of 100 µg/ml Hygromycin B (Enzo Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: pHIV-tdTomato (Addgene plasmid #21374) was constructed by Dr ...
-
bioRxiv - Genomics 2023Quote: ... The DR274 plasmid (Addgene # 42250) was used as a template for PCR using a universal primer (AAAAGCACCGACTCGGTGCCACT ...
-
bioRxiv - Genetics 2023Quote: ... and psPAX2 (Addgene plasmid #12260) lentiviral packaging plasmids ...
-
bioRxiv - Genomics 2023Quote: ... Janina Lewis (Addgene plasmid #191377) and purchased from Addgene (109).
-
bioRxiv - Neuroscience 2024Quote: ... Zhang (Addgene plasmid nos. 52963).
-
bioRxiv - Neuroscience 2023Quote: ... Viviana Gradinaru (Addgene plasmid # 103005) 83 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and PTPRJ (Addgene plasmid #51816), as well as the plasmid F11R pEBio (Addgene plasmid #61486 ...
-
bioRxiv - Neuroscience 2023Quote: ... pFUGW spCas9 (Addgene plasmid #131506) and pFUGW mCherry-KASH (Addgene plasmid #131505 ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... or coilin-GFP plasmid (Addgene) using Opti-MEM Reduced Serum Medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... pBiFC-VC155 (Addgene plasmid # 22011) [54] and pBiFC-VN155 (I152L ...
-
bioRxiv - Neuroscience 2023Quote: ... and packaging plasmids (psPAX2; Addgene) using a previously described protocol99 ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19P (Addgene plasmid # 32631), pcDNA-SADB19L (Addgene plasmid # 32632 ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19L (Addgene plasmid # 32632) and pcDNA-SADB19G (Addgene plasmid # 32633) ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19N (Addgene plasmid # 32630), pcDNA-SADB19P (Addgene plasmid # 32631) ...
-
bioRxiv - Developmental Biology 2024Quote: Both pWZ186 (Addgene plasmid #163641) and a plasmid containing 2xmTurquoise2 were double digested with Bsu36I and NgoMIV to excise 2xmKate2 and 2xmTurquoise2 ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... and psPAX2 (Addgene plasmid #12260), gifts of Didier Trono.
-
bioRxiv - Biophysics 2024Quote: ... Peter Hegemann (Addgene plasmid #115337).
-
bioRxiv - Cancer Biology 2024Quote: ... and packaging plasmids (psPAX2, Addgene). Viral supernatant was collected after 48 h and filtered through a 0.45µm filter ...
-
bioRxiv - Biophysics 2024Quote: Plasmids were obtained from Addgene as bacterial stabs and streaked onto LB-ampicillin plates ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene. Five sgRNAs were designed by CRISPOR(56 ...
-
bioRxiv - Cancer Biology 2024Quote: pDEST-V1 (Addgene plasmid 73637) and pDEST-V2 (Addgene plasmid 73638 ...
-
bioRxiv - Genetics 2024Quote: ... pRSV-Rev (Addgene plasmid # 12253) and pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Genetics 2024Quote: ... pMDLg/pRRE (Addgene plasmid # 12251), pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Genetics 2024Quote: ... LentiCRISPRv2-mCherry (Addgene plasmid # 99154) was a gift from Agata Smogorzewska ...
-
bioRxiv - Genetics 2024Quote: ... while pRS418 (Addgene plasmid #11256) was used to amplify the clonNAT cassette and also was the vector of choice for Gibson assembly cloning methodology for the promoter/allele swap experiments.
-
bioRxiv - Developmental Biology 2024Quote: ... and pCFJ104 (Addgene Plasmid #19328) at 2.5 ng/µL and 5 ng/µL concentrations respectively ...
-
bioRxiv - Genetics 2023Quote: ... pLentiV_Blast (Addgene, plasmid no. 111887) was created by Christopher Vakoc (Tarumoto et al. ...