Labshake search
Citations for Addgene :
2101 - 2150 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid version of this construct will be available on Addgene (Addgene Plasmid #174007, RRID:Addgene 174007).
-
bioRxiv - Microbiology 2022Quote: ... Plasmid psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260). pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454 ...
-
bioRxiv - Biophysics 2022Quote: ... the NLS-dCas9-NLS-GFP gene was amplified from plasmid pSLQ1658-dCas9-EGFP (Addgene, plasmid #51023) by PCR and inserted into the BamHI and XhoI restriction sites of the pcDNA5-FRT/TO plasmid (Invitrogen).
-
bioRxiv - Immunology 2023Quote: ... was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260, respectively). Briefly ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...
-
bioRxiv - Neuroscience 2023Quote: ... and serotype PHP.S or PHP.eB plasmids (a gift from Viviana Gradinaru, Addgene plasmids #103002 and #103005) with PEI Max (Polysciences ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned into the pU6-Universal plasmid (Addgene plasmid number 52694; http://n2t.net/addgene:52694; RRID:Addgene_52694). Parasites were transfected with the pU6-sgRNA plasmid containing the guide for GRA12 (A13 and A14 ...
-
bioRxiv - Microbiology 2023Quote: ... as follows: The plasmid HSV-DYN-hM4Di was a gift from John Neumaier (Addgene plasmid # 53327) [77] ...
-
bioRxiv - Microbiology 2023Quote: ... coli LC-E18 and the pSGRNA plasmid was a gift from David Bikard (Addgene plasmid # 115924) and has been described previously (Cui et al. ...
-
bioRxiv - Neuroscience 2023Quote: We subcloned split-sfGCaMP6s2 (from pGP-GCaMP6s-27) to another AAV compatible plasmid (Addgene, Plasmid#162374). We removed the M13-sfGFP1-6 fragment by digesting it from clone TOM-M13-cpGFP (Suppl ...
-
bioRxiv - Molecular Biology 2023Quote: ... this plasmid was a gift from Noboru Mizushima (Addgene plasmid #84572, http://n2t.net/addgene:84572; RRID:Addgene_84572) (37) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Biochemistry 2023Quote: ... with the only difference being the use of the pAAV2/8 packing plasmid (Addgene Plasmid #112864) for serotyping ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transformants were obtained by co-injecting this plasmid with a pCFD3-dU6:3gRNA plasmid (Addgene #49410) expressing the gRNA GACGCATTTATGGATGCGGG and screening for 3xPax3dsRED ...
-
bioRxiv - Biochemistry 2023Quote: ... lentiviral plasmids and packaging plasmids (pMD2.5G, Addgene catalog no. 12259 and psPAX2, Addgene catalog no. 12260) were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The tdTomato-luciferase plasmid was generated by recombineering using the following pMuLE system plasmids from Addgene: pMuLE ENTR U6-miR-30 L1-R5 (#62113) ...
-
bioRxiv - Developmental Biology 2023Quote: H2B-EGFP mRNA was transcribed from plasmid #1 pCS-H2B-EGFP (Megason, 2009) (Addgene, Plasmid #53744). To construct pCS2-myrTagRFP-T (plasmid #2) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and FKBP-V-P2A-BFP was cloned from pAW63.YY1.FKBP.knock-in.BFP plasmid (Addgene plasmid #104371). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... and 15μg serotype plasmid (pUCmini-iCAP-PHP.eB, a gift from Viviana Gradinaru 101, Addgene plasmid #103005). Three days following transfection ...
-
bioRxiv - Microbiology 2023Quote: ... as follows: The plasmid HSV-DYN-hM4Di was a gift from John Neumaier (Addgene plasmid # 53327) [37] ...
-
bioRxiv - Neuroscience 2023Quote: ... the trans-plasmid providing viral capsid PHP.eB (a generous gift from Viviana Gradinaru, Addgene plasmid #103005) and the cis-plasmid providing hCMV/HBA_wtCaBP2-P2A-eGFP ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pJOE7706.1 was a gift from Josef Altenbuchner (Addgene plasmid # 135075; http://n2t.net/addgene:135075; RRID:Addgene_135075). To generate plasmid pJOE7706.1-tdtomato ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-Arp3 (Wu Lab plasmid code A36) was a gift from Michael Davidson (Addgene plasmid #54981). LifeAct-GFP (Wu Lab plasmid code A11 ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments for bacterial expression were cloned into pMW96 plasmid (gift of Tarun Kapoor, Addgene plasmid #178066) which uses the T7 promoter to drive protein expression in Rosseta2
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Immunology 2024Quote: ... The OVA entry fragment was created using a PCR amplicon from OVA plasmid (Addgene plasmid 64599) with primers containing attB sites (Table 1 ...
-
bioRxiv - Immunology 2023Quote: ... The transposase plasmid pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879). The DUSP1 gene ORF (Ensembl ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmids used in this protocol were gifted from Kate O’Connor-Giles (Addgene plasmids #45946 and #51434)(Gratz et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... S499A and S499D plasmids were a gift from Stephanie Ceman (Addgene plasmids #87929, #87913 and #87914). HaloTag versions of FMRP reporters were generated by replacing GFP with HaloTag ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790 ...
-
bioRxiv - Biophysics 2024Quote: ... Lentiviral vectors were co-transfected with the lentiviral packaging plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMV-dR8.2 (Addgene plasmid #8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids containing the relevant guides were co-transfected with helper plasmids psPAX2 (Addgene Ref. 12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from plasmid UCOE-SFFV-dCas9-BFP-KRAB (Addgene plasmid #85969) as described above ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 33 Lenti_MCP-VP64_Hygro (Addgene plasmid #138458) was a gift from Jian Xu.31 EF1α-dCas9-10xGCN4_Hygro and EF1α-scFv-p65-HSF1-Blast was generated by Gibson assembly cloning (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... lenti dCAS-VP64_Blast (Addgene plasmid #61425), lentiMPH v2 (Addgene plasmid #89308 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pMD2.G plasmids (RRID: Addgene_12259) kindly provided by Marian Martínez-Balbás (IBMB-CSIC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... including 8xGTIIC-luciferase (Addgene, plasmid 3461535), SRF-RE luciferase (pGL4.34[luc2P/SRF-RE/Hygro] ...
-
bioRxiv - Cancer Biology 2021Quote: ... pQCXIH-Myc-YAP (Addgene plasmid, #33091)(Zhao et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and David Root (Addgene plasmid #81652).
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pMD2.G (Addgene Plasmid #12259), and the vector encoding either shRNA for Knockdown or overexpression Alkbh5 or Alkbh5-HA tagged at c terminal for overexpression using Fugene 6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and lentiCas9-Blast plasmid (Addgene #52962) were expanded following manufacturer’s guidelines at The Center for Advanced Genome Engineering at St ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids encoding mCherry-ADAR (Addgene number ####) and MCP-ADAR (Addgene number #### ...
-
bioRxiv - Cell Biology 2020Quote: Most plasmids were purchased from Addgene or were shared by independent labs ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmids mRuby-Clathrin (Addgene #55852), pEGFP-Sec23A (Addgene #66609) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the pX459 plasmid (Addgene #62988) for Cas9 expression and sgRNA delivery ...
-
bioRxiv - Immunology 2021Quote: ... along with psPAX2 (Plasmid #12260; Addgene) and pMD2.G (Plasmid #12259 ...
-
bioRxiv - Immunology 2021Quote: ... and pMD2.G (Plasmid #12259; Addgene) expression vectors into HEK293T cells using Lipofectamine LTX (ThermoFisher Scientific) ...