Labshake search
Citations for Addgene :
1901 - 1950 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene. Five sgRNAs were designed by CRISPOR(56 ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2024Quote: Both pWZ186 (Addgene plasmid #163641) and a plasmid containing 2xmTurquoise2 were double digested with Bsu36I and NgoMIV to excise 2xmKate2 and 2xmTurquoise2 ...
-
bioRxiv - Microbiology 2024Quote: ... SIVSAB-92018Vpr (Addgene plasmid #115822), SIVAGM-MALVpr (Addgene plasmid #115828) ...
-
bioRxiv - Microbiology 2024Quote: ... SIVCPZ-LB7Vpr (Addgene plasmid #115834), SIVgorCP684conVpr (Addgene plasmid #115835) ...
-
bioRxiv - Microbiology 2024Quote: ... and SIVrcm02CM8081Vpr (Addgene plasmid #115838) were a gift from Jeremy Luban57 ...
-
bioRxiv - Microbiology 2024Quote: ... SIVAGM-MALVpr (Addgene plasmid #115828), SIVCPZ-TAN3Vpr (Addgene plasmid #115833) ...
-
bioRxiv - Microbiology 2024Quote: ... SIVCPZ-TAN3Vpr (Addgene plasmid #115833), SIVCPZ-LB7Vpr (Addgene plasmid #115834) ...
-
bioRxiv - Microbiology 2024Quote: ... Geoff Wahl (Addgene plasmid #11680) (45) ...
-
bioRxiv - Microbiology 2023Quote: ... pMDLg/pRRE (Addgene plasmid # 12251) and pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Microbiology 2023Quote: pMD2.G (Addgene plasmid # 12259), pMDLg/pRRE (Addgene plasmid # 12251 ...
-
bioRxiv - Genetics 2023Quote: ... psPAX2 (Addgene, plasmid no. 12260) was created by Didier Trono) ...
-
bioRxiv - Cell Biology 2020Quote: ... and further into pAG423Gal-ccdB (high copy yeast expression plasmid) and pAG413Gal-ccdB (low copy yeast expression plasmid) vectors (Addgene plasmid #14149 and 14141) through standard Gateway Cloning protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Second generation lentiviral packaging plasmids psPAX and VSV-G envelope expressing plasmid pMD2.G (kind gifts from Didier Trono, Addgene plasmid #12260 and #12259) were used for the virus production ...
-
bioRxiv - Immunology 2019Quote: HEK293T cells were co-transfected with the pHR transfer plasmids with second generation packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Lipofectamine LTX Reagent (ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: The following plasmids were used for the study: pMDLg/pRRE and pRSV-Rev packaging plasmids were gifts from Didier Trono (Addgene plasmid #12251 and #12253). pCMV-VSV-G plasmid encoding for the vesicular stomatitis virus glycoprotein was a gift from Bob Weinberg (Addgene plasmid #8454) ...
-
bioRxiv - Biophysics 2023Quote: ... co-transfection of pHR transfer plasmids with second-generation packaging plasmids pMD2.G and psPAX2 (a gift from Didier Trono, Addgene plasmid #12259 and #12260) was done to produce lentivirus in HEK293T cells ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Bioengineering 2019Quote: ... plasmids were co-transfected with pCMV-VSVG (a gift from Bob Weinberg, Addgene plasmid #8454), pMDLg/pRRE ...
-
bioRxiv - Cancer Biology 2021Quote: ... were a gift from Michael Lin (Addgene plasmid # 83915; http://n2t.net/addgene:83915; RRID:Addgene_83915, Addgene plasmid # 83914; http://n2t.net/addgene:83914; RRID:Addgene_83914). The plasmid encoding Apple-53BP1trunc was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Cell Biology 2020Quote: ... CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G; Addgene) were transfected into HEK 293T cells ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and plasmid pRK5-HA-ubiquitin WT was a gift from Ted Dawson (Addgene plasmid #17608)76.
-
bioRxiv - Developmental Biology 2020Quote: The following plasmids were used: H2B-mCherry in pcDNA3 (Robert Benezra; Addgene plasmid #20972; (51)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260) We collected viral media at 24 and 48 hours and concentrated using Lenti-X Concentrator (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-Ef1α::DIO-IGK-dAPEX2-KDEL and pAAV-Ef1α::COX4-dAPEX2 were purchased from Addgene as a gift from David Ginty (Addgene plasmid #117183; http://n2t.net/addgene:117183; RRID:Addgene_117183; Addgene plasmid # 117176; http://n2t.net/addgene:117176; RRID:Addgene_117176) and packed in chimeric serotype 1/2 AAV vectors by the EMBL Genetic & Viral Engineering Facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... et al.35 The pL-CRISPR-SFFV-tRFP plasmid was obtained from Addgene (Plasmid #57826) and originally deposited by the Ebert lab.34
-
bioRxiv - Molecular Biology 2020Quote: The plasmid expressing eSpCas9(1.1)21 was a gift from Feng Zhang (Addgene plasmid #71814). The U6 promoter was replaced with a tRNA promoter22 to facilitate the expression of sgRNA guides ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... transgenes were cloned into a pShuttle-CMV plasmid (gift from Bert Vogelstein; Addgene plasmid #16403) via Gibson Assembly ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... Lentivirus particles were prepared by co-transfection with the packaging plasmid psPAX2 (Addgene Plasmid #12260) and the envelope plasmid pMD2.G (Addgene Plasmid #12259 ...
-
bioRxiv - Bioengineering 2019Quote: We modified Cas9/gRNA expressing plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) by inserting the fragment coding the targeting gRNA using digestion/ligation protocol [15] ...
-
bioRxiv - Neuroscience 2019Quote: ... and the other two were cloned using the same plasmid and plasmids acquired from Addgene. Using the orx.GCaMP6s virus ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the T7RNAPK276R sequence was PCR amplified from plasmid pRS315-nls-T7-RNAP (Addgene plasmid #33152) (30 ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were co-transfected with plasmid encoding mCherry-tagged Parkin (31) (Addgene plasmid #23956;) and encoding either ABCB-ChR2-YFP or ABCB-YFP using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: ... the mScarlet-I gene was obtained from the Lck-mScarlet-I plasmid (Addgene, plasmid #98821), and the mCherry gene was obtained from the pmCherry-N1 plasmid (Takara Bio) ...
-
bioRxiv - Microbiology 2019Quote: ... The Cas9-eGFP expression plasmid (pMJ920) was a gift from Jennifer Doudna (Addgene plasmid # 42234) (51) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pCMV5-ALK2-WT plasmid was a generous gift from Jeff Wrana (Addgene plasmid #11741). All experiments were performed using post-natal day 1 (P1 ...
-
bioRxiv - Molecular Biology 2019Quote: pcDNA3.1(+) CircRNA Mini Vector (plasmid number 60648) [19] and pcDNA3.1 plasmids both obtained from Addgene plasmid repository were used for expressing NFATc3 in cancer cells ...
-
bioRxiv - Plant Biology 2019Quote: ... placing fluorescent protein expression under the control of the cauliflower mosaic virus 35S promoter (plasmids pN_35S/mEGFP and pN_35S/mApple available at www.addgene.org as plasmids #132565 (RRID:Addgene_132565) and #132566 (RRID:Addgene_132566) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ligated into digested pspCas9(BB)-2A-puro plasmid (plasmid no. 62988, Addgene, Cambridge, MA). HEK293 cells were suspended in 2 ml of DMEM supplemented with 10% FBS and plated in 6-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... plasmids were co-transfected with pCMV-VSVG (a gift from Bob Weinberg, Addgene plasmid #8454), pMDLg/pRRE ...
-
bioRxiv - Biochemistry 2020Quote: ... pJSC173 were gifts from Jennifer Doudna and/or Keith Joung (Addgene plasmid # 39312; http://n2t.net/addgene:39312; RRID:Addgene_39312; Addgene plasmid # 101209; http://n2t.net/addgene:101209; RRID:Addgene_101209 ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...